New Genetic Variants of Anaplasma phagocytophilum and Anaplasma bovis from Korean Water Deer ( Hydropotes inermis argyropus )

Abstract

Wild deer are one of the important natural reservoir hosts of Anaplasma species, which cause granulocytic anaplasmosis in equines, canines, and humans. The objective of the present study was to determine whether and what species of Anaplasma naturally infect Korean water deer (KWD) in the Republic of Korea. A total of 66 spleens from KWD carcasses were collected by the Conservation Genome Resource Bank for Korean Wildlife in Korea between March 2008 and May 2009. Polymerase chain reaction (PCR) was performed using 16S ribosomal (r)RNA, with ankA, groEL, and msp2 gene primers to amplify the genes of Anaplasma and Ehrlichia. Using 16S rRNA-based nested PCR, Anaplasma phagocytophilum and Anaplasma bovis were detected in 42 (63.6%) and 23 (34.8%) of 66 KWD spleens, respectively. The 42 A. phagocytophilum were classified into five genotypes and the 23 A. bovis were classified into two genotypes by sequence analysis. By ankA-, groEL-, and msp2-based nested PCR, A. phagocytophilum was detected in 1 (1.5%), 7 (10.6%), and 3 (4.6%) of 66 samples, respectively. These gene sequences had only one genotype. Five of seven obtained 16S rRNA gene sequences have never been identified. The ankA, groEL, and msp2 obtained gene sequences represented new genotypes. This is the first report of A. phagocytophilum and A. bovis in KWD, suggesting that they may act as reservoirs for anaplasmosis zoonotic pathogens.

Introduction

H uman anaplasmosis, an emerging infectious disease in the United States, Europe, and Asia, is caused by an obligate intracellular tick-borne bacterium of the family Anaplasmataceae. The family Anaplasmataceae has four genera: Ehrlichia, Anaplasma, Neorickettsia, and Wolbachia. The genus Anaplasma consists of six species: Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, Anaplasma marginale, Anaplasma ovis, and Anaplasma platys (Dumler et al. 2001).

A. phagocytophilum (formerly Ehrlichia phagocytophila) is the causative agent of human granulocytic anaplasmosis (Chen et al., 1994). Anaplasmosis is a febrile disease and an acute infection in ruminants, equines, and canines (Dumler et al. 2001), which is transmitted by Ixodes ticks. A. phagocytophilum was found in a variety of animal species including bears (Drazenovich et al. 2006, Víchová et al. 2010), cats (Bjöersdorff et al. 1999), dogs (Madewell and Gribble 1982, Dumler et al. 2001), gray squirrels (Nieto and Foley 2008), horses (Madigan and Gribble 1987), mice (Tyzzer 1938, Telford et al. 1996, Liz et al. 2000), mountain lions (Foley et al. 1999), raccoons (Levin et al. 2002), voles (Walls et al. 1997, Liz et al. 2000), skunks (Levin et al. 2002), white tailed-deer (Little et al. 1998), and woodrats (Nicholson et al. 1999). In the Republic of Korea (ROK), Heo et al. (2002) and Chae et al. (2009) demonstrated antibodies against Ehrlichia chaffeensis and A. phagocytophilum among serum samples from humans with febrile illnesses and cats, horses, and cattle of otherwise unknown etiology by an indirect fluorescent antibody test and Western blotting. Moreover, A. phagocytophilum was found in wild rodents and ticks by polymerase chain reaction (PCR) (Kim et al. 2003, 2006, Oh et al. 2009).

By sequencing analysis, A. bovis is more closely related to A. phagocytophilum than to A. centrale. Infection with A. bovis has been mainly reported in African cattle; however, A. bovis was also detected in Ixodes and Haemaphysalis species ticks and sika deer (Cervus nippon yesoensis) in Japan and the ROK (Kawahara et al. 2006, Kim et al. 2006, Lee et al. 2009, Oh et al. 2009).

Wild deer are suspected reservoirs of Anaplasma and Ehrlichia species infection. In the United States, A. phagocytophilum was detected in white-tailed deer (Odocoileus virginianus), roe deer (Capreolus capreolus), and mule deer (Odocoileus hemionus) (Belongia et al. 1997, Little et al. 1998, Liz et al. 2002, Yabsley et al. 2005). In Europe, Anaplasma spp. was identified in Iberian red deer (Cervus elaphus hispanicus) and roe deer (C. capreolus) (Petrovec et al. 2002, Oporto et al. 2003, De La Fuente et al. 2004). Further, in Japan and the ROK, Anaplasma and Ehrlichia spp. have been detected in sika deer (C. nippon yesoensis) (Kawahara et al. 2006, Lee et al. 2009). These findings indicated that wild deer could be reservoirs for Anaplasma spp. infection. However, Anaplasma spp. have not been evaluated in water deer and other wild deer in Asia. Water deer (Hydropotes inermis) are indigenous to the lower reaches of rivers in China and Korea. They have two subspecies: the Korean water deer (KWD, Hydropotes inermis argyropus) and the Chinese water deer (Hydropotes inermis inermis).

The aim of the present study was to investigate the prevalence of A. phagocytophilum in KWD and determine what genotypes of Anaplasma species could infect KWD in the ROK based on multiple PCR gene sequencing. Here, we report the first molecular evidence of Anaplasma spp. among naturally infected KWD in northeastern Asia.

Materials and Methods

Sample collections

KWD carcasses (n = 66) were collected in Chungcheongbuk-do, Gangwon-do, Gyeonggi-do, and Jeollanam-do provinces and Ulsan City in the ROK between March 2008 and May 2009 by the Conservation Genome Resource Bank for Korean Wildlife. All of the carcasses were stored at −20°C until necropsy at which time the spleens were sterilely harvested. Portions of the splenic tissues (100 mg) were frozen at −80°C until DNA extraction.

DNA extraction, PCR amplification, and PCR–restriction fragment length polymorphism

DNAs were extracted from spleens using DNeasy Blood and Tissue Kits (Qiagen) according to the manufacturer's instructions. For DNA extraction, 10 mg of spleen was used. PCR and nested PCR were performed using specific primers for A. phagocytophilum and A. bovis (Table 1). The A. phagocytophilum genomic DNA provided by J. Stephen Dumler (Johns Hopkins University School of Medicine, Baltimore, MD) was used as a positive control for detecting tick-borne pathogenic Anaplasma species. The first and nested PCRs were performed in a total volume of 25 μL. Each PCR mixture consisted of 10 pmol of primers, 1 U recombinant Taq DNA polymerase (Takara Bio, Inc.), 10× PCR buffer (Takara Bio, Inc.), 2.5 mM dNTP mixture (Takara Bio, Inc.), and 10–100 ng samples of genomic DNA for the first PCR and 1 μL of the first PCR product for the second PCR. The amplification was carried out in a PTC-200 thermal cycler (MJ Research, Inc.). Table 2 shows the conditions of the PCRs. Amplified products were separated by electrophoresis on 1.5% agarose gel and visualized by ethidium bromide. PCR products were digested with restriction endonucleases HinfI and HaeIII according to the instructions of the manufacturer (ELPIS-Biotech., Inc.). The HinfI and HaeIII restriction enzymes cut the sequences 5′-G/ANTC-3′ and 5′-GG/CC-3′, respectively. The digestion products were visualized by electrophoresis on an ethidium bromide-stained 1.5% agarose gel.

Table 1.

Nucleotide Sequences of Polymerase Chain Reaction Primers and Conditions for Amplification of Anaplasma Species Genes

		Primer sequences (5′–3′)
Species and target genes	Name of PCR primers and conditions	Denaturation (°C/min)	Annealing (°C/min)	Extension (°C/min)	Cycles	PCR product size (bp)	References
Anaplasma and Ehrlichia spp. 16S rRNA	AE1-F	AAGCTTAACACATGCAAGTCGAA				1406	Oh et al. (2009)
	AE1-R	AGTCACTGACCCAACCTTAAATG
	Conditions	94/1	56/1	72/1.5	35
A. phagocytophilum 16S rRNA	EE3	GTCGAACGGATTATTCTTTATAGCTTGC				926	Barlough et al. (1996)
	EE4	CCCTTCCGTTAAGAAGGATCTAATCTCC
	Conditions	94/0.50	56/0.50	72/0.75	25
A. phagocytophilum groEL	HS1a	AITGGGCTGGTAITGAAT				1433	Liz et al. (2000)
	HS6a	CCICCIGGIACIAIACCTTC
	Conditions	88/1	48/2	68/1.5	40
	HS43	ATWGCWAARGAAGCATAGTC				1297	Lotric-Furlan et al. (1998)
	HSVR	CTCAACAGCAGCTCTAGTAGC
	Conditions	94/1	55/2	72/1.5	30
A. phagocytophilum msp2	msp2fullF	TCAGAAAGATACACGTGCGCCC				1079	Lin et al. (2004)
	msp2fullR	TTATGATTAGGCCTTTGGGCATG
	Conditions	94/1	54/1	72/1	35
	msp2F	GGTTACATAAGGGCCGCAAAGGTG				467
	msp2R	CCGGCGCATGTGTAAGGTGAAA
	Conditions	94/0.5	57/0.5	72/0.5	25
A. phagocytophilum ankA	U7	GCGTCTGTAAGGCAGATTGTG				1696	Massung et al. (2000)
	1R1	TATACACCTGGAGTAGGAAC
	Conditions	94/1	57/1	72/1.5	35
	U8	TAAGATAGGTTTAGTAAGACG				460
	1R7	TGCATCGTCATTACGCACAAGGTC
	Conditions	94/0.75	57/0.75	72/0.75	25
A. bovis 16S rRNA	ABKf	TAGCTTGCTATGGGGACAA				547	This study
	AB1r	TCTCCCGGACTCCAGTCTG					Kawahara et al. (2006)
	Conditions	94/0.5	59/0.5	72/0.5	25

PCR, polymerase chain reaction.

Table 2.

GenBank Accession Numbers of 16S Ribosomal RNA, groEL, msp2, and ankA Gene Sequences

Gene	Species	Accession no.	Country
16S rRNA	Anaplasma bovis	EU181143	ROK
		GU064902	ROK
		AB196475	Japan
		U03775	South Africa
		FJ169957	China
		GU556626	This study
		GU556627	This study
	Anaplasma centrale	AF318944	The Netherlands
	Anaplasma phagocytophilum	AY055469	USA
		AY527214	Sweden
		AY969012	Japan
		GU064895	ROK
		GU064896	ROK
		GU064897	ROK
		GU064898	ROK
		GU064899	ROK
		GU064900	ROK
		AF470700	ROK
		AB196721	Japan
		GU556621	This study
		GU556622	This study
		GU556623	This study
		GU556624	This study
		GU556625	This study
	Anaplasma platys	AF536828	Japan
		AF156784	China
	Anaplasma marginale	FJ226454	Japan
		DQ341370	China
	Ehrlichia canis	M73226	USA
		AF373613	Venezuela
	Ehrlichia chaffeensis	M73222	USA
		AF416764	USA
	Ehrlichia ewingii	U96436	USA
groEL	A. phagocytophilum	AAD51016	USA
		ABD43256	Sweden
		AAL88677	Germany
		AAS21272	USA
		AAB65625	USA
		ADO34908	This study
	A. marginale	AAO26674	Australia
	A. platys	AAP31415	Congo
	Anaplasma ovis	AAO72423	South Africa
	E. ewingii	AAF03899	USA
	Ehrlichia muris	AAF86372	USA
	Wolbachia endosymbiont	ABC87081	ROK
	Neorickettsia helminthoeca	AAL12494	Hirose strain
msp2	A. phagocytophilum	AAW32620	Switzerland
		ACO40509	Austria
		AAT51861	USA
		AAT08123	USA
		AAX07946	USA
		ADO34909	This study
	A. marginale (omp14)	ABB86404	USA
ankA	A. phagocytophilum	AAP34826	Germany
		ADA72281	Germany
		ADA72157	Slovenia
		ADA72163	Poland
		ADA72163	Norway
		AAF42730	USA
		AAR96313	Russia
		ADO34910	This study

ROK, Republic of Korea.

Cloning, nucleotide sequencing, and phylogenetic analysis

The PCR products were purified with QIAquick Gel Extraction kits (Qiagen). After purification, the amplicons were cloned with pGEM^®-T Easy Vectors (Promega Corporation), followed by transformation into Escherichia coli JM109, and then plated onto Luria-Bertani (LB) agar containing 50 μg/mL of ampicillin. Plasmid DNA for sequencing was purified using the Wizard^® Plus SV Minipreps DNA Purification System (Promega Corporation) according to the manufacturer's instructions. Purified recombinant plasmid DNA was sequenced using a T7 and SP6 promoter primer set by dideoxy termination with an automatic sequencer (ABI 3730xl capillary DNA sequencer). The obtained sequences were evaluated with Chromas software (Ver 2.33; www.technelysium.com.au/chromas.html) and were aligned using Clustal X (Ver 2.0; www.clustal.org/). The aligned sequences were examined with a similarity matrix. Relationships between individuals were assessed by the neighbor-joining method with nucleotide distance (p distance) for 100 replications with a bootstrap test. The phylogenetic tree was based on the sequences and determined using PAUP 4.0b software (Swofford 2002).

Nucleotide sequence accession numbers

The GenBank accession numbers of 16S ribosomal (r)RNA, groEL, msp2, and ankA gene sequences and specific genospecies sequences related to Anaplasmataceae pathogens for sequence comparisons are listed in Table 2.

Results

Anaplasma 16S rRNA genes were detected by conventional PCR and species-specific nested PCR assays with DNA from KWD spleens collected in the ROK (Table 2). Anaplasma spp. were detected in 50 of 66 KWD spleens (75.8%). A. phagocytophilum was identified in 42 (63.6%) specimens: 4 (80%) from Chungcheongbuk-do, 11 (73.3%) from Gangwon-do, 3 (60%) from Gyeonggi-do, 13 (72.2%) from Jeollanam-do, 8 (57.1%) from Ulsan City, and 3 (37.5%) from unknown areas. A. bovis was identified in 23 (34.8%) specimens: 4 (26.7%) from Gangwon-do, 1 (20%) from Gyeonggi-do, 8 (44.4%) from Jeollanam-do, 7 (50.5%) from Ulsan City, and 3 (37.5%) from unknown areas. In addition, 15 (22.7%) KWD were identified as being coinfected with both A. phagocytophilum and A. bovis: 4 (26.7%) from Gangwon-do, 1 (20%) from Gyeonggi-do, 7 (38.9%) from Jeollanam-do, and 3 (21.4%) from Ulsan City (Table 3).

Table 3.

Detection of Anaplasma phagocytophilum and Anaplasma bovis 16S rRNA Gene from Korean Water Deer (Hydropotes inermis argyropus) in the Republic of Korea

		No. of PCR-positive samples (%)
Area	No. of samples	A. phagocytophilum	A. bovis	Coinfection ^a
Chungcheongbuk-do	5	4 (80.0)	0	0
Gangwon-do	15	11 (73.3)	4 (26.7)	4 (26.7)
Gyeonggi-do	6	3 (50.0)	1 (16.7)	1 (16.7)
Jeollanam-do	18	13 (72.2)	8 (44.4)	7 (38.9)
Ulsan City	14	8 (57.1)	7 (50.5)	3 (21.4)
Unknown	8	3 (37.5)	3 (37.5)	0
Total	66	42 (63.6)	23 (34.8)	15 (22.7)

Infected with A. phagocytophilum and A. bovis.

To investigate the genetic relationship between the Anaplasma species detected in the deer spleens, 65 genome sequences were analyzed and compared with the fragments of 16S rRNA gene sequences. A total of 42 variants of A. phagocytophilum 16S rRNA gene sequences were divided into five genotypes by sequence similarity. Pairwise comparison revealed the presence of KWDAP1 (n = 33), KWDAP2 (n = 4), KWDAP3 (n = 3), KWDAP4 (n = 1), and KWDAP5 (n = 1) genotypes. Phylogenetic analysis indicated that four new genotypes were identified in this study and one genotype (KWDAP1) corresponded to the previously sequenced A. phagocytophilum (AY527214) (Fig. 1). The 16S rRNA gene sequences from all 42 infected deer were 98.7%–100% identical to A. phagocytophilum (AY527214).

FIG. 1.

Phylogenetic relationships among Anaplasma phagocytophilum (bold letter) detected from the Korean water deer (KWD) and Anaplasma and Ehrlichia species based on partial nucleotide sequences of the 926-bp 16S rRNA gene. The neighbor-joining method was used for constructing a phylogenetic tree. The numbers at nodes are the proportions of 100 bootstrap resamplings that support the topology shown.

Using the groEL gene-specific primer pairs shown in Table 2 for PCR, seven A. phagocytophilum groEL gene sequences were obtained from 66 KWD spleens. The product had a size of 1297 base pairs (bp) and translated 409 amino acids of groEL. The seven groEL of amino acid sequences (KWDAPg) were identical to each other and 99.7% similar to A. phagocytophilum (AF172163) from a human in the United States (Fig. 2A). The KWDAPg genotype showed 86.3% and 84.6% homology to E. chaffeensis (L10917) and Ehrlichia canis (U96731), respectively.

FIG. 2.

Phylogenetic relationships among A. phagocytophilum (bold face) detected in the KWD and Anaplasma and Ehrlichia species based on partial protein sequences of the 409-amino acid groEL (A), 151-amino acid msp2 (B), and 137-amino acid ankA (C) genes. The neighbor-joining method was used to construct a phylogenetic tree. The numbers at nodes are the proportion of 100 bootstrap resamplings that support the topology shown.

By msp2-specific nested PCR (Table 2), three A. phagocytophilum msp2 gene sequences were detected in the 66 KWD spleens. The product had a size of 457 bp and contained coding sequence for 151 amino acids of msp2. The three msp2 sequences of the amino acids (KWDAPm) were 100% identical to each other and were 89.4%–94.0% identical to A. phagocytophilum sequences from the United States (AAX07946, AAT08123, and AAT51861) (Fig. 2B).

By ankA-specific nested PCR (Table 2), only one sample of A. phagocytophilum ankA gene sequence was obtained from the 66 samples. The sequenced product was 460 bp long and included 137 amino acids of ankA (KWDAPk). The KWDAPk genotype was most similar to A. phagocytophilum from a tick (AAR96313), with 97.8% homology (Fig. 2C).

The HinfI restriction pattern of KWDAP1, KWDAP2, and KWDAP3 genotype amplified regions (three fragments: 661, 195, and 70 bp) was different from the restriction pattern produced after digestion of amplicons of KWDAP4, KWDAP5, and A. phagocytophilum Webster strain 16S rRNA gene (four fragments: 369, 292, 195, and 70 bp) (Fig. 3A). The restriction patterns using HaeIII from A. phagocytophilum groEL gene fragments showed differences between KWD samples (two fragments: 1126 and 171 bp) and A. phagocytophilum Webster strain (three fragments: 705, 421, and 171 bp) (Fig. 3B).

FIG. 3.

Polymerase chain reaction–restriction fragment length polymorphism pattern for identification of A. phagocytophilum genotypes. (A) 16S rRNA gene (926 bp) with Hinf1 digestion pattern. (B) groEL (1297 bp) gene with HaeIII digestion pattern. AP, Korean major types 1, 2, and 3; PC, positive control (Webster strain, United States, types 4 and 5; M, DNA size marker (100-bp DNA ladder; ELPIS-Biotech., Inc.).

A total of 23 samples of A. bovis 16S rRNA gene sequences were divided into two genotypes. The pairwise comparison showed the presence of KWDAB1 (n = 21) and KWDAB2 (n = 2) genotypes. The 16S rRNA sequences from all 23 infected deer were 99.8%–100% identical. A phylogenetic analysis revealed that the new KWDAB2 and KWDAB1 genotypes determined in this study corresponded to previously sequenced A. bovis (EU181143). The KWDAB2 genotype was 99.8% identical to the A. bovis (EU181143) from a tick in Korea (Fig. 4). A. bovis was not detected by ankA-, groEL-, and msp2-specific nested PCR.

FIG. 4.

Phylogenetic relationships among A. bovis (bold letter) detected in the KWD and Anaplasma and Ehrlichia species based on partial nucleotide sequences of the 547-bp 16S rRNA gene. The neighbor-joining method was used to construct a phylogenetic tree. The numbers at nodes are the proportion of 100 bootstrap resamplings that support the topology shown.

Discussion

Our results indicate that the KWD in the ROK were naturally infected with A. phagocytophilum and A. bovis. These findings suggest that KWD may play an important role in the enzootic maintenance of Anaplasma spp. in the ROK. White-tailed deer (O. virginianus) in the United States have been known to be infected with A. phagocytophilum (Belongia et al. 1997, Little et al. 1998, Arens et al. 2003). Anaplasma species have also been detected in roe deer (C. capreolus) and mule deer (O. hemionus) in the United States (Liz et al. 2002, Yabsley et al. 2005). In Europe, the prevalence of A. phagocytophilum infection in blood and spleens from roe deer (C. capreolus) and red deer (C. elaphus) was detected by serology and PCR (Alberdi et al. 2000, Liz et al. 2002, Oporto et al. 2003, De La Fuente et al. 2004). In northeast Asia including the ROK and Japan, Anaplasma species infections have been mainly reported in sika deer (C. nippon yesoensis) (Kawahara et al. 2006, Lee et al. 2009). Thus, the ROK might be in a geographic location where a high prevalence of Anaplasma species in wild deer as reservoir animals may be found.

The 16S rRNA gene sequences of A. phagocytophilum from KWD were divergent from previously reported A. phagocytophilum sequences from deer, other mammals, or ticks in the United States, Europe, and Asia (Belongia et al. 1997, Little et al. 1998, Alberdi et al. 2000, Liz et al. 2002, Arens et al. 2003, Oporto et al. 2003, De La Fuente et al. 2004, Yabsley et al. 2005) (Fig. 1). Five genotypes of A. phagocytophilum 16S rRNA gene sequences from KWD were 99.8%, 99.7%, 99.6%, 99.2%, and 98.8% similar to the genotype of the Korean tick (GU064897), 99.7%, 99.3%, 99.1%, 99.0%, and 98.9% identical to the genotype from Japanese ticks (AY969012), and 100.0%, 99.5%, 99.3%, 99.2%, and 99.1% identical to genotypes from Sweden (AY527214) and the United States (AY055469). In a previous study, we conducted PCR to test for infection by Anaplasma species from ticks from Jeju Islands, ROK. The obtained sequences (GU064895, GU064896, and GU064897) (Oh et al. 2009) were characterized as being in the same subgroup with KWDAP1, KWDAP2, and KWDAP3 genotypes (Fig. 1).

The 16S rRNA, ankA, groEL, and msp2 genes are considered to be useful molecular tools for phylogenic studies (Liz et al. 2000, Massung et al. 2000, Lin et al. 2004, Shukla et al. 2007). Therefore, we characterized three genes (ankA, msp2, and groEL) of A. phagocytophilum to distinguish other regional genotypes. The ankA, groEL, and msp2 gene sequences of A. phagocytophilum from KWD were one (1.6%), seven (10.6%), and three (4.6%), respectively. The groEL and msp2 gene sequences were identical to each other with regard to nucleotide. None of the obtained sequences had been previously reported. Three different genotypes (KWDAP1, KWDAP2, and KWDAP4) of 16S rRNA gene were shown from seven amplified groEL gene sequences in this study (data not shown). This means that genotypes of the 16S rRNA gene were not related to the groEL gene in this study. Also, the obtained sequences were easily distinguished from previously reported sequences by analysis of PCR–restriction fragment length polymorphism patterns (Fig. 3). Therefore, this may point to the existence of new major variants of A. phagocytophilum in Korean wild animals.

The prevalence of A. phagocytophilum infection in KWD determined with the use of HS43/HSVR, msp2F/msp2R, and B8/1R7 primer pairs were nearly 40, 14, and 6 times lower, respectively, than when using EE3/EE4 primer pairs. These results indicate that the detection of A. phagocytophilum infection in wild animal spleens by PCR using 16S rRNA gene primers is significantly more sensitive than when using primers that detect other genes. Our results are not consistent with the view that application of primers detecting the ankA gene increases the sensitivity of PCR for detection of A. phagocytophilum (Walls et al. 2000, Rymaszewska 2004) but are consistent with those reported by Chmielewska-Badora et al. (2007) and Fingerle et al. (1999), which indicate that the detected prevalence of A phagocytophilum can vary depending on the primers used.

A. bovis infection is not a zoonosis and can be isolated from cattle with subclinical signs such as fever, lymphadenopathy, depression, and abnormal conditions (Ooshiro et al. 2008). In the ROK and Japan, infection by A. bovis in sika deer has been reported (Kawahara et al. 2006, Lee et al. 2009). In this study, the 16S rRNA sequence homology of A. bovis retrieved from 23 KWD was 99.8%–100.0% identical and divided into two subgroups, KWDAB1 and KWDAB2 (Fig. 4). The KWDAB1 genotype was identical to A. bovis from sika deer in Japan (AB196475) and Haemaphysalis longicornis ticks in the ROK (EU181143). The KWDAB2 genotype also showed the highest sequence homology to A. bovis obtained from sika deer in Japan and H. longicornis ticks in the ROK. The KWDAB1 and KWDAB2 genotypes were 99.5% and 99.3% identical to the sequences of A. bovis from sika deer in the ROK (EU682762).

Table 3 shows that A. phagocytophilum and A. bovis were commonly detected in KWD in the ROK and coinfection by A. phagocytophilum and A. bovis was considerably higher (22.7%) than that previously reported (Kawahara et al. 2006). The KWDAP1 genotype showed three different major points with high degrees of heterogeneity observed in positions 192, 206, and 207 bp (Table 4) from previously reported sequences of A. phagocytophilum (AY527214). Also, the features of KWDAP2 and KWDAP3 genotypes were similar to the KWDAP1 genotype (Fig. 1).

Table 4.

The Variable Positions of 16S rRNA Gene Sequences (926 bp of Anaplasma phagocytophilum and 547 bp of Anaplasma bovis) from the Obtained Genotypes of Korean Water Deer

	Nucleotide positions
Genotype	63	116	192	206	207	560	602	623	741	743	760
A. phagocytophilum ^a	T	A	A	G	A	T	C	C	A	T	T
KWDAP1	+	+	T	A	G	A	+	+	+	A	A
KWDAP2	+	+	+	+	+	+	+	+	G	+	+
KWDAP3	C	+	+	+		+	T	+	A	+	+
KWDAP4	T	+	A	G	A	T	C	+	+	T	T
KWDAP5	+	G	+	+	+	+	+	T	+	+	+
A. bovis ^b	+	A	T	A	G	+	+	C	G	−	+

Bold letters indicate variable sites that are different from A. phagocytophilum partial gene, but correspond with A. bovis partial gene (192, 206, and 207 positions).

GenBank accession no. AY055469.

GenBank accession no. EU181143.

−, deletion; +, consensus sequence.

This study is the first report of molecular detection of A. phagocytophilum and A. bovis in KWD, which suggests that they may act as reservoirs for Anaplasma species pathogens. Also, seven genotypes of A. phagocytophilum and one genotype of A. bovis are new genetic variants from KWD. Our results suggest that A. phagocytophilum and A. bovis may have more than two different strains existing in the ROK based on 16S rRNA, groEL, msp2, and ankA gene sequences. Therefore, further study will be necessary to determine the relationship between public health, domestic and wild animals, and vector-borne diseases.

Footnotes

Acknowledgments

This work was supported by a National Research Foundation of Korea Grant funded by the Korean Government (2009-0071622) and through the BK21 Program for Veterinary Science.

Disclosure Statement

No competing financial interests exist.

References

Alberdi

, Walker

, Urquhart

. Field evidence that roe deer (Capreolus capreolus) are a natural host for Ehrlichia phagocytophila. Epidemiol Infect, 2000; 124:315–323.

Arens

, Liddell

, Buening

, Gaudreault-Keener

et al. Detection of Ehrlichia spp. in the blood of wild white-tailed deer in Missouri by PCR assay and serologic analysis. J Clin Microbiol, 2003; 41:1263–1265.

Barlough

, Madigan

, Derock

, Bigornia

. Nested polymerase chain reaction for detection of Ehrlichia equi genomic DNA in horses and ticks (Ixodes pacificus) Vet Parasitol, 1996; 63:319–329.

Belongia

, Reed

, Mitchell

, Kolbert

et al. Prevalence of granulocytic Ehrlichia infection among white-tailed deer in Wisconsin. J Clin Microbiol, 1997; 35:1465–1468.

Bjöersdorff

, Svendenius

, Owens

, Massung

. Feline granulocytic ehrlichiosis—a report of a new clinical entity and characterization of the infectious agent. J Small Anim Pract, 1999; 40:20–24.

Chae

, Heo

, Park

, Choi

et al. Detection of antibodies reacting with Anaplasma phagocytophilum and Ehrlichia chaffeensis from cats, horses and cattle in Korea. J Vet Clin, 2009; 26:515–519.

Chen

, Dumler

, Bakken

, Walker

. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol, 1994; 32:589–595.

Chmielewska-Badora

, Zwoliński

, Cisak

, Wójcik-Fatla

et al. Prevalence of Anaplasma phagocytophilum in Ixodes ricinus ticks determined by polymerase chain reaction with two pairs of primers detecting 16S rRNA and ankA genes. Ann Agric Environ Med, 2007; 14:281–285.

De La Fuente

, Vicente

, Hofle

, Ruiz-Fons

et al. Anaplasma infection in free-ranging Iberian red deer in the region of Castilla-La Mancha, Spain. Vet Microbiol, 2004; 100:163–173.

10.

Drazenovich

, Foley

, Brown

. Use of real-time quantitative PCR targeting the msp2 protein gene to identify cryptic Anaplasma phagocytophilum infections in wildlife and domestic animals. Vector Borne Zoonot Dis, 2006; 6:83–90.

11.

Dumler

, Barbet

, Bekker

, Dasch

et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia, and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and “HGE agent” as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol, 2001; 51:2145–2165.

12.

Fingerle

, Munderloh

, Liegl

, Wilske

. Coexistence of ehrlichiae of the phagocytophila group with Borrelia burgdoferi in Ixodes ricinus from southern Germany. Med Microbiol Immunol, 1999; 188:145–149.

13.

Foley

, Foley

, Jecker

, Swift

et al. Granulocytic ehrlichiosis and tick infestation in mountain lions in California. J Wildl Dis, 1999; 35:703–709.

14.

Heo

, Park

, Koo

, Park

et al. Serologic and molecular detection of Ehrlichia chaffeensis and Anaplasma phagocytophila (human granulocytic ehrlichiosis agent) in Korean patients. J Clin Microbilol, 2002; 40:3082–3085.

15.

Kawahara

, Yasuko

, Quan

, Emiko

et al. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl Environ Microbiol, 2006; 72:1102–1109.

16.

Kim

, Kim

, Park

et al. Identification of Ehrlichia chaffeensis, Anaplasma phagocytophilum, and A. bovis in Haemaphysalis longicornis and Ixodes persulcatus ticks from Korea. Vector Borne Zoonot Dis, 2003; 3:17–26.

17.

Kim

, Yi

, Yu

, Lee

et al. Tick-borne rickettsial pathogens in ticks and small mammals in Korea. Appl Environ Microbiol, 2006; 72:5766–5776.

18.

Lee

, Yu

, Yoon

, Li

et al. Natural co-infection of Ehrlichia chaffeensis and Anaplasma bovis in a deer in South Korea. J Vet Med Sci, 2009; 71:101–103.

19.

Levin

, Nicholson

, Massung

, Sumner

et al. Comparison of the reservoir competence of medium-sized mammals and Peromyscus leucopus for Anaplasma phagocytophilum in Connecticut. Vector Borne Zoonot Dis, 2002; 2:125–136.

20.

Lin

, Rikihisa

, Felek

, Wang

et al. Anaplasma phagocytophilum has a functional msp2 gene that is distinct from p44. Infect Immun, 2004; 72:3883–2889.

21.

Little

, Stallknecht

, Lockhart

, Dawson

et al. Natural coinfection of a whitetailed deer (Odocoileus virginianus) population with three Ehrlichia spp. J Parasitol, 1998; 84:897–901.

22.

Liz

, Anderes

, Sumner

, Massung

et al. PCR detection of granulocytic ehrlichiae in Ixodes ricinus ticks and wild small mammals in western Switzerland. J Clin Microbiol, 2000; 38:1002–1007.

23.

Liz

, Sumner

, Pfister

, Brossard

. PCR detection and serological evidence of granulocytic ehrlichial infection in roe deer (Capreolus capreolus) and chamois (Rupicapra rupicapra) J Clin Microbiol, 2002; 40:892–897.

24.

Lotric-Furlan

, Petrovec

, Zupanc

, Nicholson

et al. Human granulocytic ehrlichiosis in Europe: clinical and laboratory findings for four patients from Slovenia. Clin Infect Dis, 1998; 27:424–428.

25.

Madigan

, Gribble

. Equine ehrlichiosis in northern California: 49 cases (1968–1981) J Am Vet Med Assoc, 1987; 190:445–448.

26.

Massung

, Owens

, Ross

, Reed

et al. Sequence analysis of the ank gene of granulocytic ehrlichiae. J Clin Microbiol, 2000; 38:2917–2922.

27.

Madewell

, Gribble

. Infection in two dogs with an agent resembling Ehrlichia equi. J Am Vet Med Assoc, 1982; 180:512–514.

28.

Nicholson

, Castro

, Kramer

, Sumner

et al. Dusky-footed wood rats (Neotoma fuscipes) as reservoirs of granulocytic Ehrlichiae (Rickettsiales: Ehrlichieae) in northern California. J Clin Microbiol, 1999; 37:3323–3327.

29.

Nieto

, Foley

. Evaluation of squirrels as ecologically significant hosts for Anaplasma phagocytophilum in California. J Med Entomol, 2008; 45:763–769.

30.

, Moon

, Bae

, Shin

et al. Genetic identification and phylogenetic analysis of Anaplasma and Ehrlichia species in Haemaphysalis longicornis collected from Jeju island, Korea. J Bacteriol Virol, 2009; 39:1–11.

31.

Ooshiro

, Zakimi

, Matsukawa

, Katagiri

et al. Detection of Anaplasma bovis and Anaplasma phagocytophilum from cattle on Yonaguni Island, Okinawa, Japan. Vet Parasitol, 2008; 154:360–364.

32.

Oporto

, Gil

, Barral

, Hurtado

et al. A survey on Anaplasma phagocytophila in wild small mammals and roe deer (Capreolus capreolus) in northern Spain. Ann N Y Acad Sci, 2003; 990:98–102.

33.

Petrovec

, Bidovec

, Sumner

, Nicholson

et al. Infection with Anaplasma phagocytophila in cervids from Slovenia: evidence of two genotypic lineages. Wien Klin Wochenschr, 2002; 31:641–647.

34.

Rymaszewska

. Comparing the sensitivity of Anaplasma phagocytophilum DNA detection in Ixodes ricinus ticks by amplifying a fragment of the epank-1 and the 16S rDNA genes. Folia Med Cracov, 2004; 45:79–85.

35.

Shukla

, Aswani

, Stockwell

, Reed

. Contribution of polymorphisms in ankA, gltA and groESL in defining genetic variants of Anaplasma phagocytophilum. J Clin Microbiol, 2007; 45:2312–2315.

36.

Swofford

. Phylogenetic Analysis Using Parsimony, Version 4. Sunderland, MA: Sinauer Associates, 2002.

37.

Telford

, Dawson

, Katavolos

, Warner

et al. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc Natl Acad Sci U S A, 1996; 93:6209–6214.

38.

Tyzzer

. Cytoecetes microti, n.g., n.sp., a parasite developing in granulocytes and infection in small rodents. Parasitology, 1938; 30:242–257.

39.

Víchová

, Majláthová

, Nováková

, Straka

et al.

First molecular detection of Anaplasma phagocytophilum in European brown bear (Ursus arctos)

Vector Borne Zoonot Dis, 2010; 10:543–545.

40.

Walls

, Caturegli

, Bakken

, Asanovich

et al. Improved sensitivity of PCR for diagnosis of human granulocytic ehrlichiosis using epank1 genes of Ehrlichia phagocytophilum-group ehrlichiae. J Clin Microbiol, 2000; 38:354–356.

41.

Walls

, Greig

, Neitzel

, Dumler

. Natural infection of small mammal species in Minnesota with the agent of human granulocytic ehrlichiosis. J Clin Microbiol, 1997; 35:853–855.

42.

Yabsley

, Davidson

, Stallknecht

, Varela

et al. Evidence of tick-borne organisms in mule deer (Odocoileus hemionus) from the western United States. Vector Borne Zoonot Dis, 2005; 5:351–362.