Applications of a Sugar-Based Surveillance System to Track Arboviruses in Wild Mosquito Populations

Abstract

Effective arbovirus surveillance is essential to ensure the implementation of control strategies, such as mosquito suppression, vaccination, or dissemination of public warnings. Traditional strategies employed for arbovirus surveillance, such as detection of virus or virus-specific antibodies in sentinel animals, or detection of virus in hematophagous arthropods, have limitations as an early-warning system. A system was recently developed that involves collecting mosquitoes in CO₂-baited traps, where the insects expectorate virus on sugar-baited nucleic acid preservation cards. The cards are then submitted for virus detection using molecular assays. We report the application of this system for detecting flaviviruses and alphaviruses in wild mosquito populations in northern Australia. This study was the first to employ nonpowered passive box traps (PBTs) that were designed to house cards baited with honey as the sugar source. Overall, 20/144 (13.9%) of PBTs from different weeks contained at least one virus-positive card. West Nile virus Kunjin subtype (WNV_KUN), Ross River virus (RRV), and Barmah Forest virus (BFV) were detected, being identified in 13/20, 5/20, and 2/20 of positive PBTs, respectively. Importantly, sentinel chickens deployed to detect flavivirus activity did not seroconvert at two Northern Territory sites where four PBTs yielded WNV_KUN. Sufficient WNV_KUN and RRV RNA was expectorated onto some of the honey-soaked cards to provide a template for gene sequencing, enhancing the utility of the sugar-bait surveillance system for investigating the ecology, emergence, and movement of arboviruses.

Introduction

The last two decades have seen an unprecedented range expansion and increase in incidence of human and animal disease attributed to arboviruses such as dengue, West Nile, chikungunya, bluetongue, and Schmallenberg viruses (Mackenzie et al. 2004, Wilson and Mellor 2009, Burt et al. 2012, Hoffmann et al. 2012). Australia is vulnerable to arbovirus outbreaks, as demonstrated by periodic dengue epidemics, the expansion of Japanese encephalitis virus (JEV) into Australasia, and the emergence of a highly pathogenic strain of West Nile virus, Kunjin subtype (WNV_KUN), in horses in southeastern Australia in 2011 (Hanna et al. 1996, Hanna and Ritchie 2009, Frost et al. 2012). Arbovirus surveillance is often undertaken with the objective of detecting the virus so that disease mitigation strategies can be implemented to prevent clinical cases (van den Hurk et al. 2012).

The 1974 outbreak of Murray Valley encephalitis (MVEV) in southeastern Australia was the catalyst for the establishment of a sentinel chicken system in several of the mainland Australian states (Campbell and Hore 1975, Bennett 1976, Spencer et al. 2001). Virus isolation from mosquitoes is also used to supplement the sentinel chicken flocks. This system has been used to successfully detect elevated MVEV activity, including the relatively recent epidemic transmission in 2000 and 2011 (Brown et al. 2002, Knox et al. 2012). In the state of Queensland, sentinel pigs have been deployed to detect incursions of JEV, and mosquito trapping for virus isolation is conducted in response to human cases of encephalitis due to MVEV (Spencer et al. 2001, Shield et al. 2006). Unfortunately, much of the arbovirus activity in Australia occurs in rural and remote areas, where deploying sentinel animals or conducting routine mosquito trapping for virus isolation is logistically difficult.

We have developed a novel method of surveillance whereby mosquitoes collected in CO₂-baited updraft box traps have access to honey-baited cards, and any viruses expectorated on the cards during sugar feeding by infected mosquitoes are detected using molecular assays (Hall-Mendelin et al. 2010). The advantage of this system is that traps can be deployed for weeks in the field without servicing, and there is no need to analyze the mosquitoes themselves, an often laborious process. In a proof-of-concept field evaluation, the alphaviruses Ross River virus (RRV) and Barmah Forest (BFV) virus were detected from cards in multiple updraft box traps over different weeks. Despite the success of this field trial, issues with the motorized components of the updraft trap led to the development of a nonmechanical trap, the passive box trap (PBT), which collected comparable mosquito numbers to traditional traps (Ritchie et al. 2013).

In this article, we report the operational deployment of the sugar-baited surveillance system in northern Australia to detect flavivirus and alphavirus activity in wild mosquito populations. Specifically, we tested the utility of PBTs for collecting mosquitoes, providing access to the honey-soaked cards and subsequent virus detection. In addition, we compared the sugar-baited system to the sentinel chicken program that is run to detect MVEV and WNV_KUN in the Northern Territory. Finally, the viral RNA expectorated onto the honey-soaked cards provided a template for sequencing, revealing valuable information on virus strains circulating in the region.

Materials and Methods

Study locations

Five locations in northern Australia were included in this study and were chosen based on reports of previous arbovirus activity or were situated where regular servicing of traps was feasible, such as Emerald (Fig. 1). Leanyer and Beatrice Hill, near Darwin, Northern Territory, have a history of WNV_KUN and MVEV activity, as evidenced by seroconversion of sentinel chicken flocks (Whelan and Burrow 1994, Kurucz et al. 2005). These sites were also chosen because sentinel chickens are deployed annually, allowing for a direct comparison between the two forms of surveillance. A human case of MVEV was reported from Mt. Isa in Queensland in 2001, and mosquito isolates of WNV_KUN and MVEV were obtained during the subsequent investigations (Hills 2001). Seisia in the Northern Peninsula Area of Queensland is one of the locations on the Australian mainland where JEV was detected during one of two incursions onto the mainland (Hanna et al. 1999), and it is also where the Northern Australia Quarantine Strategy operates a sentinel cattle herd.

FIG. 1.

The study sites in northern Australia. The city of Brisbane is included, because this is where the diagnostic laboratory was located and where all honey-soaked Flinders Technology Associates (FTA) cards were processed for the presence of viral RNA.

Trapping strategy

Honey-baited Flinders Technology Associates (FTA) cards were produced by cutting 25-×25-mm squares from standard FTA cards (Whatman International Ltd, Maidstone, UK) and soaking them overnight with honey (Hall-Mendelin et al. 2010). To limit the impact of mosquito crowding blocking access to the honey-baited cards, fipronil (Termidor, BASF, Ludwigshafen, Germany) was added to the honey to create a solution containing 0.06% active ingredient (Ritchie et al. 2013). Six honey-soaked FTA cards were housed within CO₂-baited PBTs that were used for all mosquito collections (Ritchie et al. 2013). At each site, the trap configuration consisted of two PBTs set approximately 20 meters apart. CO₂ from a compressed gas cylinder was provided to each trap by way of a 5-mm hose, which had been split with a t-splitter, with each trap receiving 250 mL/min of gas. A timer was attached to each regulator so that gas was released during the evening (1800–2100 h) and preceding the morning (0300–0600 h) crepuscular periods. Two of these trap configurations were deployed at each site, giving a total of four PBTs at each site, with the exception of Seisia, where one trap configuration was set.

The traps at Emerald, Leanyer, and Beatrice Hill were serviced weekly. Due to the remoteness of their locations, the traps at Mt. Isa and Seisia were serviced at least fortnightly. The cards were removed from the traps, placed between Parafilm M (Pechiney Plastic Packaging, Chicago, IL), sealed in a plastic snap-lock bag, and forwarded by post to Queensland Health Forensic and Scientific Services, Brisbane, for analysis. Despite the remoteness of some locations, it generally took only 2–3 days from the collection of cards, postal transit, molecular analysis, and the final output of results.

Sentinel animals

The use of chickens complied with the Northern Territory Animal Welfare Act 2000 and was approved by the Charles Darwin University Animal Ethics Committee (AEC; approval number A11033). The use of cattle complied with the Queensland Animal Care and Protection Act of 2001 and was approved by the Department of Employment, Economic Development, and Innovation AEC (approval number CA 2012/03/595). Trapping at the Leanyer and Beatrice Hill sites was conducted in parallel with the sentinel chicken program run by Northern Territory Health. Each of the sites has a flock of 10–12 chickens. Chickens were bled monthly, and the serum samples tested for MVEV- and WNV_KUN-specific antibodies using a modified virus neutralization assay (Uren 1993). Briefly, 50 μL of serially diluted serum was incubated with 50 μL of medium containing 10² tissue culture infectious dose (TCID)₅₀ per well of either MVEV (strain MRM66) or WNV_KUN (strain MRM16) for 1 h at 37°C in 96-well plates. Then 100 μL of medium containing African green monkey kidney (Vero) cells at 2×10⁵ cells/mL was added and the plates were read after incubation for a further 6 days at 37°C. The sentinel cattle herd in Seisia is bled monthly, and flavivirus antibodies are detected using an enzyme-linked immunosorbent assay (ELISA) and plaque reduction neutralization test (PRNT) (Hall et al. 1995, Pant et al. 2006).

Virus elution and extraction from FTA cards

To elute viral RNA, FTA cards were first cut into four to five strips and placed in a 5-mL vial with 1 mL of ddH₂O. Vials were placed on wet ice and vortexed for 15 s every 5 min for a total of 20 min. The cards were then placed in a syringe from which the plunger had been removed. The plunger was then used to squeeze the remaining liquid into a 2 mL vial. Viral RNA was extracted from the eluates using a BioRobot Universal System (Qiagen, Hilden, Germany) using the QIAamp^® Virus BioRobot^® MDx Kit (Qiagen, Clifton Hill, Australia) according to the manufacturer's instructions.

Virus detection

Viral RNA eluted from the FTA cards was detected using real-time TaqMan RT-PCR assays with modifications (Pyke et al. 2004, Hall et al. 2011, Smith, I.L., unpublished data). The reaction mix was prepared using the Superscript III Platinum one-step quantitative (q) RT-PCR system (Invitrogen, Carlsbad, CA) and contained 0.4 μL of Superscript^™ III RT/Platinum^® Taq mix, 10 μL of 2×reaction mix, primers, and probes according to required final concentration (Table 1), 50 nM ROX Reference Dye, 5 μL of extracted viral RNA or diluted synthetic control, and H₂O to produce a final volume of 20 μL. The TaqMan RT-PCR cycling conditions consisted of one cycle at 50°C for 5 min, one cycle at 95°C for 2 min, and 50 cycles at 95°C for 3 sec and 60°C for 30 sec. The threshold cycle number (C _t) was determined for each sample, and a negative result indicating no RNA detection corresponded to any C _t value that was ≥45 cycles. Controls for each assay included positive and negative extraction controls, synthetic primers and probes (Pyke et al. 2004, Hall et al. 2011; I.L. Smith, unpublished), and no-template controls.

Table 1.

Oligonucleotide Primers and Probes Used in the TaqMan Assays and RT-PCR

Virus	Assay	Primer or probe name	Gene ^a	5′-3′sequence	Final conc. ^b	Reference
BFV	TaqMan	Primer BFV-F	E2	AGTGTGGCAGTACAACTCCCAAT	300 nM	I.L. Smith, unpublished data
		Primer BFV-R	E2	AAGGCACATGGATCTTTCCTTTC	300 nM	I.L. Smith, unpublished data
		Probe BFV-FAM	E2	6FAM-CGTGCCCAGGTCCGAAGTTACGG-TAMRA	150 nM	I.L. Smith, unpublished data
JEV	TaqMan	JEV MGB TAQ For 10486	3′UTR	GTGCTGYCTGCGTCTCAGT	600 nM	M.J. Finger, unpublished data
		JEV MGB TAQ REV 10566	3′UTR	GAGACGGTTRTGAGGGCTTTC	600 nM	M.J. Finger, unpublished data
		JEV MGB PROBE 10514	3′UTR	6FAM-ACTGGGTTAACAAATCTGACA-MGB	400 nM	M.J. Finger, unpublished data
MVEV	TaqMan	MVE-FOR	NS5	ATCTGGTGYGGAAGYCTCA	900 nM	Pyke et al. (2004)
		MVE-REV	NS5	CGCGTAGATGTTCTCAGCCC	900 nM	Pyke et al. (2004)
		MVE-FAM	NS5	6FAM-ATGTTGCCCTGGTCCTGGTCCCT-MGB	200 nM	Pyke et al. (2004)
RRV	TaqMan	Primer RRV E2 F	E2	ACGGAAGAAGGGATTGAGTACCA	390 nM	Hall et al. (2011)
		Primer RRV E2 R	E2	TCGTCAGTTGCGCCCATA	390 nM	Hall et al. (2011)
		Probe RRV-FAM	E2	6FAM-CAACAACCCGCCGGTCCGC-TAMRA	244 nM	Hall et al. (2011)
	RT-PCR	RRV8741F	E2	GCAGGTACCCACGCCCACAC	500 nM	A.T. Pyke, unpublished data
		RRV9230R	E2	GCAGCATGGCATTGGTCTAT	500 nM	A.T. Pyke, unpublished data
		RRV8866F	E2	CATCGTCGCACACTGTCCAC	500 nM	A.T. Pyke, unpublished data
		RRV9130R	E2	TGCCGCCTGCTGTTATTTTG	500 nM	A.T. Pyke, unpublished data
WNV_KUN	TaqMan	Kunjin-F	NS5	AACCCCAGTGGAGAAGTGGA	400 nM	Pyke et al. (2004)
		Kunjin-R	NS5	TCAGGCTGCCACACCAAA	400 nM	Pyke et al. (2004)
		Kunjin MGB Probe	NS5	6FAM-CGATGTTCCATACTCTGG-MGB	135 nM	M.J. Finger, unpublished data
	RT-PCR	Kun9169F	NS5	GACCACTGGCTTGGAAGAAA	500 nM	Frost et al. (2012)
		Kun10955R	3′UTR	CTGGTTGTGCAGAGCAGAAG	500 nM	Frost et al. (2012)
		Kun9860R	NS5	CGGCATGGAACCACCAGTGTTC	500 nM	Frost et al. (2012)

Virus gene that the assay targets: E2, envelope protein 2; 3′UTR, 3′-untranslated region; NS5, nonstructural protein 5.

Concentration of primers and probes within each reaction.

BFV, Barmah Forest virus; JEV, Japanese encephalitis virus; MVEV, Murray Valley encephalitis virus; RRV, Ross River virus; WNV_KUN, West Nile virus Kunjin subtype.

Nucleic acid sequencing

Sequencing of viral RNA detected on FTA cards was performed using a nested RT-PCR targeting the nonstructural protein (NS) 5 gene (NS5) for WNV_KUN and the envelope 2 (E2) gene for RRV as described by Frost et al. (2012), and using primers listed in Table 1. The second-round PCR reaction for RRV consisted of 15 μL of the Qiagen Fast cycling PCR Master Mix (Qiagen, Clifton Hill, Australia) as per the manufacturer's instructors and used 5 μL of DNA and had an annealing temperature of 50°C.

Sequencing was performed on the CEQ8000 Genetic Analysis System (Beckman Coulter, Fullerton, CA) using the standard LFR-1 program provided by the manufacturer. Phylogenetic analysis was conducted using MEGA5 by maximum likelihood method (Tamura et al. 2011).

Results

The trial commenced on February 15, 2012, and concluded on June 28, 2012, although the actual date that trapping commenced and concluded differed between sites. A total of 864 honey-soaked FTA cards were analyzed from a total of 144 PBT collections. Overall, virus was detected on 30/864 (3.5%) cards removed from 20/144 (13.9%) of the PBTs, and with the exception of Seisia, all sites yielded virus detections (Fig. 2). In total, 13/20 (65.0%), 5/20 (25.0%), and 2/20 (10.0%) of positive traps yielded at least one card positive for WNV_KUN, RRV, or BFV, respectively. Neither MVEV or JEV was detected during the trial. Emerald had the highest number of positive PBTs (10/20 [50%]) and accounted for the greatest number of WNV_KUN- (8/13 [61.5%]) positive PBTs. Although 6/20 (30%) PBTs contained multiple virus-positive cards, none of the PBTs contained cards positive for more than one virus.

FIG. 2.

Temporal depiction of the detection of arboviruses in honey-soaked Flinders Technology Associates (FTA) cards housed in CO₂-baited passive box traps (PBTs). Each box represents a single PBT, and the number within boxes refers to the number of cards from which viral RNA was detected. The viruses detected were West Nile virus Kunjin subtype (black shading), Ross River virus (grey shading), and Barmah Forest virus (hatched). Seisia is not included, because no virus was detected from this location. The date displayed is the date that the cards were collected.

At the two Northern Territory sites, where PBTs were deployed in parallel with the sentinel chickens, 4/62 (6.5%) of PBTs were positive for WNV_KUN. In contrast, zero out of 110 serum samples obtained from the chickens contained antibodies to MVE or WNV_KUN. Likewise, no antibodies to JEV, MVEV, or WNV_KUN were detected in the sentinel cattle deployed at Seisia.

Sufficient WNV_KUN RNA template for sequencing was obtained from a WNV_KUN-positive card obtained from Leanyer, and RRV sequences were obtained from two positive cards collected from Emerald. Phylogenetic analysis of a 651-bp region of the NS5 gene of the WNV_KUN sequence (accession no. KC480552) demonstrated that this virus was identical to WNV_KUN MRM16 (accession no. GQ851602), was 98.9% homologous to WNV_KUN MRM61C (accession no. AY274504), and 95.1% homologous to the 2011 WNV_KUN strain (accession no. JN887352) from southeastern Australia (Fig. 3A). The two RRV sequences (accession nos. KC480550 and KC480551) were identical. The 243-bp region of the E2 gene of RRV was identical to a strain isolated in 2004 from northeast Queensland (accession no. GQ433354) and 97.9% homologous to a 1969 RRV strain from Port Stephens, New South Wales (accession no. M20162) (Fig. 3B).

FIG. 3.

Phylogenetic relationship of the West Nile virus Kunjin subtype (S3083) sequence (A) and Ross River virus (S2809 and S2810) sequences (B) obtained from the honey-soaked Flinders Technology Associates (FTA) cards with selected sequences. Both viruses shown are maximum-likelihood trees produced in the MEGA5 program. West Nile virus Kunjin subtype was analyzed with 651 nucleotides of the NS5 gene. Ross River virus was analyzed with 243 nucleotides of the E2 gene.

Discussion

Previously, we reported that a sugar-baited surveillance system has the capacity to detect RRV and BFV in wild mosquito populations (Hall-Mendelin et al. 2010). The current study demonstrates that this system has utility for detecting flaviviruses, as evidenced by the numerous detections of WNV_KUN. However, two of the most important encephalitic flaviviruses in Australia, MVEV and JEV, were not detected from any of the sites. The paucity of JEV at the Seisia site was not surprising, because this virus has not been detected on the Australian mainland since 2004 (van den Hurk et al. 2006). In contrast, MVEV is considered to be endemic in northern Australia, being responsible for occasional human cases of encephalitis, as well as being detected in sentinel chickens and mosquitoes (Knox et al. 2012). During the trapping period, sentinel chickens at the Northern Territory sites failed to seroconvert to any flaviviruses, including MVEV. Correspondingly, no MVEV was detected on the cards. The lack of MVEV detection in the PBTs may reflect the fact that this virus was not circulating at detectable levels during the trial and not the inability of this system to detect this virus. The potential utility of this system for detecting MVEV was demonstrated during the initial stages of development, whereby viral RNA was readily detected on sugar-soaked substrates removed from batches of infected mosquitoes (van den Hurk et al. 2007).

The ability for the sugar-based surveillance system to detect arboviruses when the sentinel chickens did not seroconvert suggests that it may be a more sensitive method of surveillance than sentinel animals. The sugar-based system does not suffer from some of the limitations of sentinel animals, such as difficulty in distinguishing between closely related viruses in serological assays employed to detect antibodies in serum samples, animal ethics considerations, or the need for husbandry (Ritchie et al. 2007). The system also possesses advantages when compared to traditional mosquito-based surveillance. In instances where virus isolation is used as the mode of detection, maintenance of a logistically challenging cold-chain is required to preserve infectious virus present in mosquito pools (Ritchie et al. 2003). Even when molecular methods are employed for detection, there are issues with RNases present in mosquito pools degrading viral RNA. To assist with virus preservation, the FTA cards are impregnated with proprietary chemicals that inhibit microbial growth and protect the viral RNA from degradation. Further antibacterial activity was offered by the honey used as the sugar attractant on the FTA cards (Weston et al. 2000, Lusby et al. 2005).

Northern Australia experiences high temperatures and humidity during the wet season, which can exacerbate the wear and tear on motorized traps. The PBT was not only developed to circumvent the issues associated with powered traps, such as component malfunction, but also the need to access electricity to power the traps. In efficacy evaluations conducted in northern Queensland, the PBTs collected comparable and, in some cases, higher numbers of mosquitoes than Centers for Disease Control light traps (Ritchie et al. 2013). Only limited attempts were made to quantify the number of mosquitoes collected in the PBTs deployed during our field trial. However, mosquito collections of thousands of individuals were observed, and a single week's collection obtained from Emerald in February, 2012, yielded approximately 29,000 mosquitoes estimated by weight, of which approximately 95% were the primary RRV and WNV_KUN vector Culex annulirostris. Because Ritchie et al. (2013) had demonstrated that mosquitoes in PBTs baited with fipronil-laced honey-soaked cards had a mean mortality of 94% versus 5% in a nontreated control trap, we added fipronil to the honey on the cards in the current trial. This helped kill mosquitoes that had fed on the cards, thus providing newly collected mosquitoes access to the honey cards.

Despite the PBT being an effective and inexpensive trap, the need to rely on CO₂ to attract mosquitoes to the PBT remains a problem with this sugar-based surveillance system. Fermentation-derived CO₂ does hold some promise, although the rate of output declines rapidly and is generally less than that produced by compressed gas or dry ice (Smallegange et al. 2010). Furthermore, the timers used to regulate CO₂ gas output occasionally malfunctioned in our study, which obviously reduced the number of mosquitoes attracted to the trap. A different approach to exploiting mosquito sugar feeding to track arboviruses was recently reported from California (Lothrop et al. 2012). In that system, WNV RNA was detected on sugar-soaked wicks scented with the floral attractant acetaldehyde. However, the majority of WNV detections were obtained in hot and dry conditions, where competition for natural floral nectaries may have been limited. Nonetheless, sugar-soaked substrates scented with floral attractants may have some utility in the Australian context as an alternative to CO₂-based systems.

This trial provided the opportunity to evaluate the molecular diagnostics used for virus detection and establish whether sample preparation and assay sensitivity could be improved. For instance, it was a laborious process to prepare the FTA cards for RNA extraction, with approximately 2 h required to elute the RNA from 24 individual cards, representing one site's weekly collection of cards. We are currently assessing whether cards from each trap could be batched, without losing sensitivity. This would reduce the number of samples processed from each location from 24 to four, thus reducing costs and the turnaround time between sample receipt and output of results. The C _t scores on positive cards were often in excess of 35 cycles in the TaqMan RT-PCR, indicating that only a small amount of viral RNA was present. Thus, it was essential to assess the integrity of the amplification plot in samples that had high C _t scores for them to be considered positive. Furthermore, cards considered positive with a C _t score above 38 cycles were also reanalyzed using a nested RT-PCR or TaqMan RT-PCR to confirm these borderline positive results. The small quantity of virus present on the cards is not surprising, given that mosquitoes expectorate approximately 4.7 nL of saliva during feeding (Devine et al. 1965, Hurlbut 1966) and that the cards can remain in the field for periods of up to 2 weeks before being dispatched to a diagnostic laboratory.

Despite the small amounts of viral RNA on the honey-soaked FTA cards, some cards yielded sufficient template for gene sequencing. Importantly, RNA sequenced directly from the cards was derived directly from the mosquito sample, without downstream passage in cell culture. Phylogenetic analysis of the WNV_KUN circulating at Leanyer revealed that this virus was identical in the region of the NS5 gene analyzed to WNV_KUN MRM16, the type strain of the virus, which was isolated 50 years previously from Kowanyama (formerly Mitchell River Mission) on western Cape York Peninsula (Doherty et al. 1963). However, the sequence shared just over 95% homology with the WNV_KUN strain that caused a devastating outbreak of equine encephalitis in southeastern Australia in 2011 (Frost et al. 2012). The RRV sequence was identical in the 243-bp region to a human isolate from northeastern Queensland and a mosquito isolate from New South Wales (Faragher et al. 1988, Jones et al. 2010), further demonstrating the utility of this system for providing a template for gene sequencing and tracking arboviruses of importance to human and animal health.

Footnotes

Acknowledgments

This study would not have been possible without the assistance of a great many people. For assistance with the field components of this study, we thank Jaana Wenham, Neville Hunt, Scott Lyons, Tim Kerlin, James Bond, and Eric Cottis. We also thank Doris Genge and Sarah Wheatley for assistance in performing the molecular diagnostics. Thanks are also due to Debra El Saadi and Keith Rickart for their input into the formulation of the current studies. This work was funded by the Queensland Health Communicable Diseases Unit.

Author Disclosure Statement

The authors are not aware of any commercial associations or biases that might be perceived as affecting the objectivity of this research paper.

References

Bennett

. Murray Valley encephalitis, 1974: clinical features. Med J Aust, 1976; 2:446–450.

Brown

, Bolisetty

, Whelan

, Smith

, et al. Reappearance of human cases due to Murray Valley encephalitis virus and Kunjin virus in central Australia after an absence of 26 years. Comm Dis Intell, 2002; 26:39–44.

Burt

, Rolph

, Rulli

, Mahalingam

, et al. Chikungunya: a re-emerging virus. Lancet, 2012; 379:662–671.

Campbell

, Hore

. Isolation of Murray Valley encephalitis virus from sentinel chickens. Aust Vet J, 1975; 51:1–3.

Devine

, Venard

, Myser

. Measurement of salivation by Aedes aegypti (L.) feeding on a living host. J Insect Physiol., 1965; 11:347–353.

Doherty

, Carley

, Mackerras

, Marks

. Studies of arthropod-borne virus infections in Queensland. III. Isolation and characterisation of virus strains from wild-caught mosquitoes in north Queensland. Aust J Exp Biol Med Sci, 1963; 41:17–39.

Faragher

, Meek

, Rice

, Dalgarno

. Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus. Virology, 1988; 163:509–526.

Frost

, Zhang

, Edmonds

, Prow

, et al. Characterization of virulent West Nile virus Kunjin strain, Australia, 2011. Emerg Infect Dis, 2012; 18:792–800.

Hall

, Broom

, Hartnett

, Howard

, et al. Immunodominant epitopes on the NS1 protein of MVE and KUN viruses serve as targets for a blocking ELISA to detect virus-specific antibodies in sentinel animal serum. J Virol Methods, 1995; 51:201–210.

10.

Hall

, Prow

, Pyke

. Ross River virus In: Liu

ed. Molecular Detection of Human Viral Pathogens. Boca Raton, FL: CRC Press, 2011:349–359.

11.

Hall-Mendelin

, Ritchie

, Johansen

, Zborowski

, et al. Exploiting mosquito sugar feeding to detect mosquito-borne pathogens. Proc Natl Acad Sci USA, 2010; 107:11255–11259.

12.

Hanna

, Ritchie

. Outbreaks of dengue in north Queensland, 1990–2008. Comm Dis Intell, 2009; 33:32–33.

13.

Hanna

, Ritchie

, Phillips

, Shield

, et al. An outbreak of Japanese encephalitis in the Torres Strait, Australia, 1995. Med J Aust, 1996; 165:256–260.

14.

Hanna

, Ritchie

, Phillips

, Lee

, et al. Japanese encephalitis in north Queensland, Australia, 1998. Med J Aust, 1999; 170:533–536.

15.

Hills

. Murray Valley encephalitis in Mt Isa, north Queensland. Comm Dis Intell, 2001; 25:48.

16.

Hoffmann

, Scheuch

, Hoper

, Jungblut

, et al. Novel orthobunyavirus in Cattle, Europe, 2011. Emerg Infect Dis, 2012; 18:469–472.

17.

Hurlbut

. Mosquito salivation and virus transmission. Am J Trop Med Hyg, 1966; 15:989–993.

18.

Jones

, Lowry

, Aaskov

, Holmes

, Kitchen

. 2010. Molecular evolutionary dynamics of Ross River virus and implications for vaccine efficacy. J Gen Virol, 2010; 91:182–188.

19.

Knox

, Cowan

, Doyle

, Ligtermoet

, et al. Murray Valley encephalitis: a review of clinical features, diagnosis and treatment. Med J Aust, 2012; 196:322–326.

20.

Kurucz

, Whelan

, Jacups

, Broom

, Melville

. Rainfall, mosquito vector numbers and seroconversions in sentinel chickens to Murray Valley encephalitis virus in the Northern Territory. Arbovirus Res Aust, 2005; 9:188–192.

21.

Lothrop

, Wheeler

, Fang

, Reisen

. Use of scented sugar bait stations to track mosquito-borne arbovirus transmission in California. J Med Entomol, 2012; 49:1466–1472.

22.

Lusby

, Coombes

, Wilkinson

. Bactericidal activity of different honeys against pathogenic bacteria. Arch Med Res, 2005; 36:464–647.

23.

Mackenzie

, Gubler

, Petersen

. Emerging flaviviruses: the spread and resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med, 2004; 10:S98–S109.

24.

Pant

, Lunt

, Rootes

, Daniels

. Serological evidence for Japanese encephalitis and West Nile viruses in domestic animals of Nepal. Comp Immunol Microbiol Infect Dis, 2006; 29:166–175.

25.

Pyke

, Smith

, van den Hurk

, Northill

, et al. Detection of Australasian Flavivirus encephalitic viruses using rapid fluorogenic TaqMan RT-PCR assays. J Virol Methods, 2004; 117:161–167.

26.

Ritchie

, Pyke

, Smith

, Northill

, et al. 2003. Field evaluation of a sentinel mosquito (Diptera: Culicidae) trap system to detect Japanese encephalitis in remote Australia. J Med Entomol, 2003; 40:249–252.

27.

Ritchie

, van den Hurk

, Zborowski

, Kerlin

, et al. Operational trials of remote mosquito trap systems for Japanese encephalitis virus surveillance in the Torres Strait, Australia. Vector Borne Zoonotic Dis, 2007; 7:497–506.

28.

Ritchie

, Cortis

, Paton

, Townsend

, et al. A simple non-powered passive trap for the collection of mosquitoes for arbovirus surveillance. J Med Entomol, 2013; 50:185–194.

29.

Shield

, Hanna

, Phillips

. Reappearance of the Japanese encephalitis virus in the Torres Strait, 1996. Comm Dis Intell, 2006; 20:191.

30.

Smallegange

, Schmied

, van Roey

, Verhulst

, et al. Sugar-fermenting yeast as an organic source of carbon dioxide to attract the malaria mosquito Anopheles gambiae . Malar J, 2010; 9:292.

31.

Spencer

, Azoulas

, Broom

, Buick

, et al. Murray Valley encephalitis virus surveillance and control initiatives in Australia. Comm Dis Intell, 2001; 25:33–47.

32.

Tamura

, Peterson

, Stecher

, et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 2011; 28: 2731–2739.

33.

Uren

. Bovine ephemeral fever—Pathology, virology and serology. In: Corner

, Bagust

, eds, Australian Standard Diagnostic Techniques for Animal Disease. East Melbourne: CSIRO for the Standing Committee on Agriculture and Resource Management, 1993:1–8.

34.

van den Hurk

, Montgomery

, Northill

, Smith

, et al. The first isolation of Japanese encephalitis virus from mosquitoes collected from mainland Australia. Am J Trop Med Hyg, 2006; 75:21–25.

35.

van den Hurk

, Johnson

, Hall-Mendelin

, Northill

, et al. Expectoration of flaviviruses during sugar feeding by mosquitoes (Diptera: Culicidae). J Med Entomol, 2007; 44:845–850.

36.

van den Hurk

, Hall-Mendelin

, Johansen

, Warrilow

, Ritchie

. Evolution of mosquito-based arbovirus surveillance systems in Australia. J Biomed Biotech, 2012; 2012:325659.

37.

Weston

, Brocklebank

, Lu

. Identification and quantitative levels of antibacterial components of some New Zealand honeys. Food Chem, 2000; 70:427–435.

38.

Whelan

, Burrow

. Australian encephalitis in the NT. North Terr Commun Dis Bull, 1994; 2:21–23.

39.

Wilson

, Mellor

. Bluetongue in Europe: past, present and future. Philos Trans R Soc Lond B Biol Sci, 2009; 364:2669–2681.