The Prevalence of Zoonotic Tick-Borne Pathogens in Ixodes Scapularis Collected in the Hudson Valley,New York State

Abstract

Ixodes scapularis, the blacklegged tick, is capable of transmitting the pathogens that cause Lyme disease (Borrelia burgdorferi), babesiosis (Babesia microti), anaplasmosis (Anaplasma phagocytophilum), and to a lesser extent Powassan encephalitis (deer tick virus [DTV]). These pathogens represent significant public health problems, but little is known about the occurrence and co-infection prevalence of these pathogens in I. scapularis. Here, we used standard PCR and pathogen-specific primers to estimate the prevalence of infection of A. phagocytophilium, B. burgdorferi, B. microti, and Ehrlichia chaffeensis in questing nymph and adult I. scapularis collected from sites in Putnam and Dutchess counties in southern New York in 2011. To detect DTV infection, cell cultures were observed for the presence of cytopathic effects and positive results were confirmed via real time RT-PCR. In 466 individually sampled adult ticks, B. burgdorferi had the highest prevalence of infection (55%) followed by A. phagocytophilum (18.2%), DTV (3.4%), B. microti (3.2%), and E. chaffeensis (1.5%). Infection with two pathogens occurred in 13.3% of ticks, and 10 ticks were infected with three combinations of three pathogens. These results provide an estimate of the rate of co-infection, which then can help inform the epidemiological risk of contracting multiple zoonotic tick-borne pathogens within the Hudson Valley region of New York State.

Introduction

Ticks are obligate ectoparasites of vertebrates that require blood for development and egg production. They are extremely important in human and veterinary medicine, acting as vectors of viral, bacterial, and protozoan pathogens (de la Fuente et al. 2008). Moreover, the incidence of tick-borne diseases is increasing worldwide (Jongejan and Uilenberg 2004, Nicholson et al. 2010, Piesman et al. 2012). For example, more than 250,000 human cases of Lyme borreliosis were reported from 2000 to 2010 in the United States, and the disease also is increasing in Europe, where over 50,000 human cases are reported annually (Piesman et al. 2012). The spectrum of tick-borne diseases affecting domestic animals and humans also has increased in recent years with the emergence of many important zoonotic tick-borne illnesses, such as anaplasmosis, babesiosis, ehrlichiosis, and members of the tick-borne encephalitis serocomplex including Powassan virus (POWV; Flaviridae, Flavivirus) (de la Fuente et al. 2012). The pathogens that cause these diseases represent significant public health problems, and climate change, forest fragmentation, and urbanization are enhancing opportunities for contact with humans and pets (Allan et al. 2003, Gray et al. 2009, Eisen et al. 2012).

Ixodes scapularis, the blacklegged tick, is capable of transmitting the pathogens that cause Lyme disease (Borrelia burgdorferi), babesiosis (Babesia microti), and anaplasmosis (Anaplasma phagocytophilum) (Spielman et al. 1979, Burgdorfer et al. 1982, Pancholi et al. 1995). I. scapularis also has been implicated as a vector for one of two lineages of POWV, deer tick virus (DTV) (for review, see Ebel 2010, Dupuis et al. 2013). All of these agents can coexist in I. scapularis, and often they are found in the same geographic locale. As a result, there is an increased risk of being inoculated with several of these agents at once from a single tick bite (Benach et al. 1985, Magnarelli et al. 1998, Belongia et al. 1999, De Martino et al. 2001, Krause et al. 2002). However, the risk of human co-infection differs by geographic location, and the true prevalence of co-infecting pathogens among Ixodes ticks remains largely unknown for the majority of geographic locations (Swanson et al. 2006).

Accordingly, we estimated the prevalence of infection of A. phagocytophilum, B. burgdorferi, B. microti, and DTV in I. scapularis collected from sites in Putnam and Dutchess counties of southern New York in 2011, a region where populations of the tick are dense (Schauber et al. 1998). In addition, ticks were screened for the presence of Ehrlichia chaffeensis despite I. scapularis never being incriminated as a vector for this pathogen. This was done because Amblyomma americanum, the primary vector of E. chaffeensis, has been repeatedly collected in the study area beginning in 2005 (NYSDOH Tick Identification Service, personal communication). The data presented herein provide information on the level of interaction of I. scapularis with numerous pathogens, as well as providing an estimate of the rate of co-infection. These data then can help inform the epidemiological risk of contracting multiple zoonotic tick-borne pathogens within the Hudson Valley region of New York State (NYS).

Methods

Study areas and tick collections

For this study, ticks were collected at two sites east of the Hudson River, one in Putnam County and one in Dutchess County, during June to December in 2011. The Putnam County site was located on a farm that contained fields surrounded by forest. The Dutchess County site contained forest and an overgrown pasture. Both sites were associated with oak-dominated eastern deciduous forest with barberry and honeysuckle shrubs along the edges. Questing I. scapularis nymphs and adult ticks were collected by standard drag-sampling protocol (Ostfeld et al. 1996) during the annual peak in nymph and adult questing activity. A 1-meter by 1-meter white corduroy cloth was dragged along the ground and flagged across low brush and vegetation. Ticks were counted and collected every 15–30 s. Questing ticks were sorted by species and developmental stage and placed in glass vials containing moistened Plaster of Paris^™ until processing. All tick processing was performed at the Arbovirus Laboratories, Wadsworth Center, NYS Department of Health (DOH).

DNA extractions and PCR analyses

Adult ticks and nymphs were placed in individual tubes containing 1 mL of diluent (20% heat-inactivated fetal bovine serum [FBS] in Dulbecco phosphate-buffered saline [D-PBS] plus 50 μg of penicillin/streptomycin mL⁻¹, 50 μg of gentamicin mL⁻¹, and 2.5 μg of Fungizone mL⁻¹). The mixture was homogenized using a mixer mill (Qiagen, Valencia, CA) and clarified by centrifugation. Pool size ranged from a single individual to a maximum pool size of 10. Genomic DNA then was extracted from 180 μL of homogenate using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer's instructions. The Taq PCR Core Kit (Qiagen) was used for PCR analyses with a final concentration of 0.2 μmol of forward primer, 0.2 μmol of reverse primer, 1×PCR buffer, 200 μmol/L of each deoxyribonucleotide triphosphate (dNTP), 1 U of Taq (Qiagen), and 5 μL of extracted genomic DNA. Conditions necessary for PCR amplification were as follows: 95°C for 15 min and then 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 mi, concluding with a final 10-min extension at 72°C. Primer sequences are listed in Table 1 and were based on previously published primer sets (Persing et al. 1990, Persing et al. 1992, Pancholi et al. 1995, Wagner et al. 2004). Amplification products were run on 2% agarose gels.

Table 1.

List of Oligonucleotide Primers in 5′ to 3′ Orientation

Oligonucleotide	Amplicon size (bp)	Sequence	Pathogen	Reference
OspA4 (forward) OspA2 (reverse)	158	GTTTTGTAATTTCAACTGCTGACC CTGCAGCTTGGAATTCAGGCACTTC	Borrelia burgdorferi	Persing et al. 1990
ECH84-101 (forward) ECH360-341 (reverse)	277	AGGTAGTGGTATTAACGG AGATACTTCAAGCTCTATTC	Ehrlichia chaffeensis	Wagner et al. 2004
Bab1 (forward) Bab4 (review)	238	CTTAGTATAAGCTTTTATACAGC ATAGGTCAGAAACTTGAATGATACA	Babesia microti	Persing et al. 1992
Ehr521 (forward) Ehr747 (reverse)	247	TGTAGGCGGTTCGGTAAGTTAAAG GCACTCATCGTTTACAGCGTG	Anaplasma phagocytophilum	Pancholi et al. 1995

The ability of the B. burgdorferi, B. microti, and A. phagocytophilum primer sets to distinguish between other closely related species found in North America is unclear (e.g., Borrelia andersonii, Babesia odocoilei, and/or Anaplasma odocoilei). As such, it should be noted that co-endemicity of strain variants not associated with human illness in our study area may inadvertently inflate prevalence rates. As a positive control for B. burgdorferi, we used DNA extracted from cultured, high-passage B. burgdorferi strain B31. As a positive control for B. microti, we used DNA extracted from the blood of an infected, female C3H/EN mouse. As a positive control for A. phagocytophilum, we used DNA extracted from an infected, adult male I. scapularis (all three courtesy of Melissa Prusinski, Wadsworth Center, NYS DOH). As a positive control for E. chaffeensis, DNA was extracted from cultured E. chaffeensis (courtesy of Linda Gebhardt, Wadsworth Center, NYS DOH), a 277-bp portion of the outer membrane protein gene (p28) was amplified and cloned (Topo TA Cloning Kit, Invitrogen, Carlsbad, CA), and 0.3 pg of plasmid DNA was used in PCR reactions. Ultrapure water was used as a negative control for all PCR reactions to account for potential contamination.

Cell culture for DTV

Baby hamster kidney cells (BHK; ATCC #CCL-10) were grown in minimal essential medium (MEM; Gibco, Carlsbad, CA) supplemented with 10% FBS (Hyclone, Logan, UT), 2 mM l-glutamine, 1.5 grams/L sodium bicarbonate, 100 U/mL of penicillin, and 100 μg/mL of streptomycin and incubated at 37°C in 5% CO₂. Six- or twelve-well plates containing confluent monolayers of BHK cells were inoculated with 100 or 50 μL of tick homogenate, respectively. After 1 h of adsorption at 37°C, fresh MEM containing 2% FBS (additionally supplemented with 50 μg/mL gentamicin and 2.5 μg/mL Fungizone) was added and plates were incubated at 37°C for up to 10 days postinoculation. Cultures were observed daily for the presence of cytopathic effect (CPE), aliquots were removed from CPE-positive samples, and samples were stored at −80°C. Viral RNA was extracted from 140 μL of cell culture supernatant using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer's instructions. The presence of DTV was confirmed via real time RT-PCR using a DTV-specific primer/probe set. The primer/probe set targeted DTV nonstructural protein 5. Oligonucleotide primer and probe sequences were as follows: Forward, 5′-GATCATGAGAGCGGTGAGTGACT-3′; reverse, 5′-GGATCTCACCTTTGCTATGAATTCA-3′; probe, 5′-6FAM-TGAGCACCTTCACAGCCGAGCCAG-TAMRA-3′.

Results and Discussion

We tested 323 questing nymphs and 922 questing adult I. scapularis from two field sites in the Hudson Valley of NYS for infection with five tick-borne pathogens: A. phagocytophilum, B. burgdorferi, B. microti, E. chaffeensis, and DTV. Ticks were pooled, and pool sizes ranged from a single individual to a maximum pool size of 10 (median pool size=five); however, of the 561 adult tick pools analyzed, 83% were individual ticks. Pool size and the number of pathogens detected only showed a moderate positive correlation (Pearson's correlation coefficient=0.351), i.e., as pool size increased, the number of pathogens detected did not necessarily increase (Table 2). Maximum likelihood estimation of infection rates (MLE-IR) was used to estimate the proportion of infected individuals in positive pools. MLE-IR is defined as the infection rate (per 1000) most likely observed given the testing results and an assumed probabilistic model, i.e., binomial distribution of infected individuals in a positive pool (Gu et al. 2003). True co-infection prevalence could only be determined from individual ticks, and these values are presented as such. Finally, for most of the pathogens detected, there were significant differences in the MLE-IRs between Dutchess and Putnam counties (summarized in Table 3), and these data may represent geographical variation in epidemiological risk. However, any attempt to perform a more robust analysis to assess the potential significant spatial and temporal variations at these two locations is confounded by the fact that tick collections only occurred over a single transmission season, collection efforts varied by study site, relative tick abundance across sites was not measured, and vertebrate host censuses were not conducted.

Table 2.

Summary of Pathogens Detected in Ixodes scapularis in Both Counties

Tick stage	Anaplasma phagocytophilum	Borrelia burgdorferi	Babesia microti	Ehrlichia chaffeensis	Deer tick virus
	# of positive pools (% of total)
Nymphs (67 total)	23 (34%)	45 (67%)	13 (19%)	1 (1.5%)	0 (0%)
Adults (561 total)	129 (23%)	338 (60%)	22 (4%)	11 (2%)	27 (5%)

Pool size ranged from a single individual to a maximum pool size of 10. Median pool size=5.

Table 3.

Ixodes scapularis Maximum Likelihood Estimation of Infection Rates by County

	Nymphs
County	B. burgdorferi	A. phagocytophilum	B. microti	E. chaffeensis	Deer tick virus
Dutchess	231.74	76.52	49.58	3.47	0
Putnam	96.14	146.68	0	0	0
p value^a	0.0001	0.0001	0.0001	0.125	N/D
Combined	212.72	84.04	43.72	3.1	0

		Adults
Dutchess	544.06	198.92	30.11	9.86	5.94
Putnam	466.69	111.54	17.06	12.04	30.04
p value^a	0.001	0.0001	0.075	0.831	0.0001
Combined	506.78	157.58	24.24	12.04	30.04

Calculated using the Fisher exact test.

N/D, no data.

Borrelia burgdorferi

B. burgdorferi is the etiologic agent of Lyme disease, the most common vector-borne disease in the United States (Bacon et al. 2008). As expected, B. burgdorferi was the most commonly detected pathogen in the samples tested: 61% (n=383/628 pools) of samples tested positive (Table 2). The MLE-IR for Borrelia-infected adult I. scapularis was 506.78 per 1000 and 212.72 per 1000 for infected nymphs (Table 3).

Anaplasma phagocytophilum

Human granulocytic anaplasmosis (HGA), formerly known as human granulocytic ehrlichiosis, is an emerging infectious disease in the United States, Europe, and Asia (Demma et al. 2005, Jin et al. 2012). In the United States, most reported cases are concentrated in north-central and northeastern states. Here, A. phagocytophilum DNA was detected in 24% (n=152/628 pools) of tick samples tested. There were significantly more Anaplasma-positive nymph samples as compared to Anaplasma-positive adult tick samples (p=0.049) (Table 2), but the MLE-IR for Anaplasma-infected adult I. scapularis was 157.58 per 1000 versus 84.04 per 1000 for infected nymphs (Table 3). This disparity likely is due to the fact that nymphs were pooled, whereas, adult ticks were primarily sampled as single individuals.

Babesia microti

Human babesiosis is a growing public health concern in the northeastern United States. In the lower Hudson Valley region of NYS, five locally acquired cases of babesiosis were reported in 2001 (Kogut et al. 2005). The incidence had increased 20-fold from 2001 through 2008 (Joseph et al. 2011). We detected B. microti DNA in 6% (n=25/628 pools) of samples tested. There were significantly more Babesia-positive nymph samples as compared to Babesia-positive adult tick samples (p=0.0001) (Table 2). The MLE-IR for Babesia-infected adult I. scapularis was 24.24 per 1000 and 43.47 per 1000 for infected nymphs (Table 3).

Ehrlichia chaffeensis

E. chaffeensis is maintained in a cycle involving white-tailed deer (Odocoileus virginianus) and the lone star tick, A. americanum. But recent data have indicated that E. chaffeensis can been found in many species of ticks and vertebrate hosts (Yabsley 2010). We detected E. chaffeensis DNA in 2% (n=12/628 pools) of samples tested. There was no significant difference in the number of Ehrlichia-positive nymph samples as compared to Ehrlichia-positive adult tick samples (p=1.00) (Table 2). The MLE-IR for Ehrlichia-infected adult I. scapularis was 12.04 per 1000 and 3.10 per 1000 for infected nymphs (Table 3). This low rate of detection likely had to do with the fact that the primary vector for E. chaffeensis is not I. scapularis (Yabsley 2010). Still, E. chaffeensis DNA can be detected in multiple tick species, and, as a result, these data can be useful as a sensitive method for indirectly detecting E. chaffeensis in human and animal populations. This becomes especially relevant considering the recent range expansion of A. americanum into the northeastern United States (Mixson et al. 2004). However, positive test results from I. scapularis do not demonstrate that transmission by this vector occurs in the study area, but rather confirms what is known from human cases that this agent is present in the area.

Deer tick virus

In North America, POWV is the sole representative of the tick-borne encephalitis serocomplex of the flaviviruses. POWV comprises two genetic lineages, including the prototype lineage (POWV, lineage I) and a second lineage that first was described in the late 1990s (DTV, lineage II) (Telford III et al. 1997). POWV has been considered to be a minor public health concern due to the relative host specificity of its tick vector, Ixodes cookei and/or Ixodes marxi (Ebel et al. 2000). Whereas, DTV is thought to be a greater public health threat, because it mainly has been associated with I. scapularis and therefore has a more likely opportunity to come into contact with humans (Hinten et al. 2008, Tavakoli et al. 2009, Dupuis et al. 2013). DTV was only detected in adult samples (5% of adult samples; 27/561) (Table 2). The MLE-IR for DTV-infected adult I. scapularis was 30.04 per 1000 (Table 3).

Co-infection

Of the 922 questing adult I. scapularis collected for this study, 466 individual ticks were assayed for their infection status with the same five tick-borne pathogens as mentioned in the previous sections. B. burgdorferi had the highest prevalence of infection (55%) followed by A. phagocytophilum (18.2%), DTV (3.4%), B. microti (3.2%), and E. chaffeensis (1.5%). Infection with two pathogens occurred in 13.3% of ticks, and 10 ticks were infected with three combinations of three pathogens (summarized in Table 4).

Table 4.

Summary of Pathogens Detected in Individual, Adult Ticks in Both Counties

Ixodes scapularis (466 total)	Anaplasma phagocytophilum	Borrelia burgdorferi	Babesia microti	Ehrlichia chaffeensis	Deer tick virus
Number of positive ticks (% of total)	85 (18.2%)	258 (55%)	15 (3.2%)	7 (1.5%)	16 (3.4%)
Forty-eight ticks with B. burgdorferi and A. phagocytophilum co-infection.
Five ticks with B. burgdorferi and B. microti co-infection.
Seven ticks with B. burgdorferi and DTV co-infection.
Two ticks with B. burgdorferi and E. chaffeensis co-infection.
Seven ticks with A. phagocytophilum, B. burgdorferi, and B. microti polyinfection.
Two ticks with B. burgdorferi, E. chaffeensis, and DTV polyinfection.
One tick with A. phagocytophilum, B. burgdorferi, and DTV polyinfection.

Molecular evidence of co-infection with multiple human pathogens has been demonstrated for Ixodes ticks sampled from select geographic areas of California, Wisconsin, and the northeastern United States (Piesman et al. 1986, Pancholi et al. 1995, Holden et al. 2003, Schulze et al. 2013). The highest prevalences of co-infected I. scapularis were reported from regions endemic for Lyme disease in the northeastern United States, with reported co-infection prevalences up to 28% (e.g., Schauber et al. 1998). Here, we report a prevalence of infection with two pathogens in 466 adult I. scapularis to be 13.3%, and this is consistent with other reports from NYS (Schwartz et al. 1997, Schauber et al. 1998, Tokarz et al. 2010). In contrast, studies from other North American regions generally have reported lower prevalences of co-infected Ixodes ticks, e.g., 1–4% (Pancholi et al. 1995, Schulze et al. 2013).

Few studies have identified simultaneous infection with three or more tick-borne pathogens. For example, Adelson et al. (2004) did not detect triple infection in I. scapularis ticks collected in New Jersey during surveillance for B. burgdorferi, A. phagocytophilum, and B. microti (Adelson et al. 2004). And, others did not identify molecular evidence of polyinfection in Ixodes ticks, despite reporting co-infection prevalences ranging from 1% to 10% (Telford III et al. 1996, Varde et al. 1998, Holman et al. 2004). However, Tokarz et al. (2010) recently reported a polyinfection prevalence of 4.8% in I. scapularis collected on Long Island in NYS. They collected I. scapularis triple-infected with B. burgdorferi, A. phagocytophilum, and B. microti. They also collected a single tick that was infected with four pathogens: B. burgdorferi, A. phagocytophilum, B. microti, and B. miyamotoi. Here, we report a polyinfection prevalence of 1.5% for adult I. scapularis infected with B. burgdorferi, A. phagocytophilum, and B. microti. We also collected two ticks infected with B. burgdorferi, E. chaffeensis, and DTV, and a single tick infected with B. burgdorferi, A. phagocytophilum, and DTV (Table 4).

Conclusions

High co-infection rates increase the likelihood that an individual could be inoculated with multiple pathogens following a single tick bite. Lyme disease and HGA are the two most commonly reported diseases resulting from the bite of I. scapularis. In our study, 19% of ticks infected with B. burgdorferi also were co-infected with A. phagocytophilum (Table 4), suggesting that in the areas sampled, there is a high probability of co-transmission of these two organisms. This is consistent with recent meta-analyses of co-infection in Ixodes ricinus–complex ticks that confirm the high frequency of co-infection of these two pathogens (Nieto et al. 2009, Civitello et al. 2010). However, human risk is multifactorial, and prevalence of infection does not define risk on its own. For example, the duration of attachment powerfully modifies risk; and the interaction between microbes during co-infection and the effects on the fitness and survival of co-infected vectors are poorly known. Within the vector, all of the microbes mentioned in this study share several common barriers (e.g., the environment within the midgut and the salivary gland infection barrier), but little is known about how they might all interact within a co-infected vector. Additionally, the interactions among microbes within the same human or animal host following polyinfection and how this might alter disease severity or alter the course of disease development and the dynamics of transmission remain unknown. Nevertheless, these results demonstrate that individual blacklegged ticks simultaneously infected with two or three zoonotic pathogens are not uncommon in this study area.

Footnotes

Acknowledgments

The authors thank the Wadsworth Center Tissue Culture Core facility for providing BHK cells; Linda Gebhardt for providing DNA for an E. chaffeensis–positive control; and Melissa Prusinski for providing A. phagocytophilum, B. burgdorferi, and B. microti DNA positive controls. This project was funded by National Institutes of Health (NIH) grant no. AI088169-02. M.T.A. was supported by the Wadsworth Center Biodefense and Emerging Infectious Disease postdoctoral fellowship, NIH T32AI055429.

Author Disclosure Statement

No competing financial interests exist.

References

Adelson

, Rao

, Tilton

, Cabets

, et al. Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia microti, and Anaplasma phagocytophila in Ixodes scapularis ticks collected in Northern New Jersey. J Clin Microbiol, 2004; 42:2799–2801.

Allan

, Kessing

, Ostfeld

. Effect of forest fragmentation on Lyme disease risk. Cons Biol, 2003; 17:267–272.

Bacon

, Kugeler

, Mead

. Surveillance for Lyme disease—United States, 1992–2006. MMWR Surveill Summ, 2008; 57:1–9.

Belongia

, Reed

, Mitchell

, Chyou

, et al. Clinical and epidemiological features of early Lyme disease and human granulocytic ehrlichiosis in Wisconsin. Clin Infect Dis, 1999; 29:1472–1477.

Benach

, Coleman

, Habicht

, MacDonald

, et al. Serological evidence for simultaneous occurrences of Lyme disease and babesiosis. J Infect Dis, 1985; 152:473–477.

Burgdorfer

, Barbour

, Hayes

, Benach

, et al. Lyme disease-a tick-borne spirochetosis?. Science, 1982; 216:1317–1319.

Civitello

, Rynkiewicz

, Clay

. Meta-analysis of co-infection in ticks. Israel J Ecol Evol, 2010; 56:417–431.

de la Fuente

, Estrada-Pena

, Venzal

, Kocan

, et al. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci, 2008; 13:6938–6946.

de la Fuente

, Estrada-Pena

. Ticks and tick-borne pathogens on the rise. Ticks Tick Borne Dis, 2012; 3:115–116.

10.

De Martino

, Carlyon

, Fikrig

. Coinfection with Borrelia burgdorferi and the agent of human granulocytic ehrlichiosis. N Engl J Med, 2001; 345:150–151.

11.

Demma

, Holman

, McQuiston

, Krebs

, et al. Epidemiology of human ehrlichiosis and anaplasmosis in the United States, 2001–2002. Am J Trop Med Hyg, 2005; 73:400–409.

12.

Dupuis

, Peters

, Prusinski

, Falco

, et al. Isolation of deer tick virus (Powassan virus, lineage II) from Ixodes scapularis and detection of antibody in vertebrate hosts sampled in the Hudson Valley, New York State. Parasit Vectors, 2013; 6:185.

13.

Ebel

. Update on Powassan virus: Emergence of a North American tick-borne flavivirus. Annu Rev Entomol, 2010; 55:95–110.

14.

Ebel

, Campbell

, Goethert

, Spielman

, et al. Enzootic transmission of deer tick virus in New England and Wisconsin sites. Am J Trop Med Hyg, 2000; 63:36–42.

15.

Eisen

, Piesman

, Zielinski-Gutierrez

, Eisen

. What do we need to know about disease ecology to prevent Lyme disease in the northeastern United States?. J Med Entomol, 2012; 49:11–22.

16.

Gray

, Dautel

, Estrada-Pena

, Kahl

, et al. Effects of climate change on ticks and tick-borne diseases in Europe. Interdiscp Perspect Infect Dis, 2009; 2009:1–12.

17.

, Lampman

, Novak

. Problems in estimating mosquito infection rates using minimum infection rate. J Med Entomol, 2003; 40:595–596.

18.

Hinten

, Beckett

, Gensheimer

, Pritchard

, et al. Increased recognition of Powassan encephalitis in the United States, 1999–2005. Vector Borne Zoonotic Dis, 2008; 8:733–740.

19.

Holden

, Boothby

, Anand

, Massung

. Detection of Borrelia burgdorferi, Ehrlichia chaffeensis, and Anaplasma phagocytophilum in ticks (Acari: Ixodidae) from a coastal region of California. J Med Entomol, 2003; 40:534–539.

20.

Holman

, Caporale

, Goldberg

, Lacombe

, et al. Anaplasma phagocytophilum, Babesia microti, and Borrelia burgdorferi in Ixodes scapularis, southern coastal Maine. Emerg Infect Dis, 2004; 10:744–746.

21.

Jin

, Wei

, Liu

, Qian

. Epidemiology and control of human granulocytic anaplasmosis: A systematic review. Vector Borne Zoonotic Dis, 2012; 12:269–274.

22.

Jongejan

, Uilenberg

. The global importance of ticks. Parasitology, 2004; 129(Suppl):S3–S14.

23.

Joseph

, Roy

, Shams

, Visintainer

, et al. Babesiosis in Lower Hudson Valley, New York, USA. Emerg Infect Dis, 2011; 17:843–847.

24.

Kogut

, Thill

, Prusinski

, Lee

, et al. Babesia microti, upstate New York. Emerg Infect Dis, 2005; 11:476–478.

25.

Krause

, McKay

, Thompson

, Sikand

, et al. Disease-specific diagnosis of coinfecting tickborne zoonoses: Babesiosis, human granulocytic ehrlichiosis, and Lyme disease. Clin Infect Dis, 2002; 34:1184–1191.

26.

Magnarelli

, Ijdo

, Anderson

, Padula

, et al. Human exposure to a granulocytic Ehrlichia and other tick-borne agents in Connecticut. J Clin Microbiol, 1998; 36:2823–2827.

27.

Mixson

, Ginsberg

, Campbell

, Sumner

, et al. Detection of Ehrlichia chaffeensis in adult and nymphal Amblyomma americanum (Acari: Ixodidae) ticks from Long Island, New York. J Med Entomol, 2004; 41:1104–1110.

28.

Nicholson

, Allen

, McQuiston

, Breitschwerdt

, et al. The increasing recognition of rickettsial pathogens in dogs and people. Trends Parasitol, 2010; 26:205–212.

29.

Nieto

, Foley

. Meta-analysis of coinfection and coexposure with Borrelia burgdorferi and Anaplasma phagocytophilum in humans, domestic animals, wildlife, and Ixodes ricinus-complex ticks. Vector Borne Zoonotic Dis, 2009; 9:93–101.

30.

Ostfeld

, Hazler

, Cepeda

. Temporal and spatial dynamics of Ixodes scapularis (Acari: Ixodidae) in a rural landscape. J Med Entomol, 1996; 33:90–95.

31.

Pancholi

, Kolbert

, Mitchell

, Reed

Jr. , et al. Ixodes dammini as a potential vector of human granulocytic ehrlichiosis. J Infect Dis, 1995; 172:1007–1012.

32.

Persing

, Telford

III , Spielman

, Barthold

. Detection of Borrelia burgdorferi infection in Ixodes dammini ticks with the polymerase chain reaction. J Clin Microbiol, 1990; 28:566–572.

33.

Persing

, Mathiesen

, Marshall

, Telford

, et al. Detection of Babesia microti by polymerase chain reaction. J Clin Microbiol, 1992; 30:2097–2103.

34.

Piesman

, Mather

, Telford

III , Spielman

. Concurrent Borrelia burgdorferi and Babesia microti infection in nymphal Ixodes dammini . J Clin Microbiol, 1986; 24:446–447.

35.

Piesman

, Beard

. Prevention of tick-borne diseases. J Environ Health, 2012; 74:30–32.

36.

Schauber

, Gertz

, Maple

, Ostfeld

. Coinfection of blacklegged ticks (Acari: Ixodidae) in Dutchess County, New York, with the agents of Lyme disease and human granulocytic ehrlichiosis. J Med Entomol, 1998; 35:901–903.

37.

Schulze

, Jordan

, Healy

, Roegner

. Detection of Babesia microti and Borrelia burgdorferi in host-seeking Ixodes scapularis (Acari: Ixodidae) in Monmouth County, New Jersey. J Med Entomol, 2013; 50:379–383.

38.

Schwartz

, Fish

, Daniels

. Prevalence of the rickettsial agent of human granulocytic ehrlichiosis in ticks from a hyperendemic focus of Lyme disease. N Engl J Med, 1997; 337:49–50.

39.

Spielman

, Clifford

, Piesman

, Corwin

. Human babesiosis on Nantucket Island, USA: Description of the vector, Ixodes (Ixodes) dammini, n. sp. (Acarina: Ixodidae). J Med Entomol, 1979; 15:218–234.

40.

Swanson

, Neitzel

, Reed

, Belongia

. Coinfections acquired from Ixodes ticks. Clin Microbiol Rev, 2006; 19:708–727.

41.

Tavakoli

, Wang

, Dupuis

, Hull

, et al. Fatal case of deer tick virus encephalitis. N Engl J Med, 2009; 360:2099–2107.

42.

Telford

III , Dawson

, Katavolos

, Warner

, et al. Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle. Proc Natl Acad Sci USA, 1996; 93:6209–6214.

43.

Telford

III , Armstrong

, Katavolos

, Foppa

, et al. A new tick-borne encephalitis-like virus infecting New England deer ticks, Ixodes dammini . Emerg Infect Dis, 1997; 3:165–170.

44.

Tokarz

, Jain

, Bennett

, Briese

, et al. Assessment of polymicrobial infections in ticks in New York State. Vector Borne Zoonotic Dis, 2010; 10:217–221.

45.

Varde

, Beckley

, Schwartz

. Prevalence of tick-borne pathogens in Ixodes scapularis in a rural New Jersey County. Emerg Infect Dis, 1998; 4:97–99.

46.

Wagner

, Bremer

, Rikihisa

, Ewing

, et al. Development of a p28-based PCR assay for Ehrlichia chaffeensis . Mol Cell Probes, 2004; 18:111–116.

47.

Yabsley

. Natural history of Ehrlichia chaffeensis: Vertebrate hosts and tick vectors from the United States and evidence for endemic transmission in other countries. Vet Parasitol, 2010; 167:136–148.