Characterization of Two Strains of Tribeč Virus Isolated in Ukraine

Abstract

During arbovirus surveillance in Ixodes ricinus ticks in South Ukraine, two strains of Tribeč virus were isolated using an in vivo method and characterized using the complement fixation text (CFT), hemagglutination assay (HA), electron microscopy, and molecular methods. Both strains replicated well in the BHK-21, PEC, and Vero cell lines and demonstrated 95% nucleotide identity in their VP3 sequences compared with the reference VP3 sequence for Tribeč virus. These two strains of Tribeč virus were named Tr35 and Tr19. Also, segment reassortment involving Tr35, Tr19, TRBV, and LIPV strains was shown.

Introduction

Historically, researchers were not very interested in the Orbivirus genus within the Reoviridae family because of the negligible role of orbiviruses in pathology. There are only three species in the Orbivirus genus—blue tongue virus (BTV), African horse sickness virus (AHSV), and epizootic hemorrhagic disease virus (EHDV)—that play a significant role in the pathology of infected domestic animals (Kind et al 2012). A considerable number of articles about orbiviruses are concentrated on the study of these three viruses. However, the genus Orbivirus comprises 22 species, and some of these species circulate in Eurasia (Hubálek and Rudolf 2012). Moreover, the closely related Kemerovo virus (KEMV) and Tribeč virus (TRBV) have been reported to cause neurological disorders in humans (Dilcher et al. 2012). Currently, TRBV and KEMV, as well as Lipovnik virus (LIPV), are included in the Great Island virus (GIV) subgroup and are transmitted by ticks (Belhouchet et al 2010). TRBV and LIPV were originally isolated by Czechoslovakian scientists in 1963 in western Slovakia, whereas KEMV was isolated in western Siberia during an expedition headed by academician M.P. Chumakov (Chumakov et al. 1963, Libikova et al 1965).

Over the past 5 years, interest in orbiviruses has been increasing, and some publications have focused on the characterization of novel orbiviruses, as well as formally known, although poorly characterized, strains and species of the Orbivirus genus (Cowled et al. 2009, Belaganahalli et al. 2011, Belaganahalli et al. 2012, Kapoor et al. 2013, Cooper et al. 2014). To contribute to the study of orbiviruses, we report the study of two strains of TRBV, Tr35 and Tr19, isolated in southern Ukraine.

Materials and Methods

Sampling

During an arbovirus surveillance and control program, ixodid ticks were collected in South Ukraine, and two viral strains were isolated. Strain Tr35 was isolated from 75 questing males of Ixodes ricinus ticks collected by flagging (0.7×1.1 m) from vegetation near Dibrovka village (49°10′N, 30°47′E) in the Kotovsky district of the Odessa region in 1988.

Strain Tr19 was isolated from three female I. ricinus ticks collected from a dog in the Serbino hole (47°56′N, 29′37′E) in the Balta district of the Odessa region in 2008 (Fig. 1). The I. ricinus identity and sex of the ticks were determined based on morphology following the recommendations of Dr. Filippova (1977). All of the ticks were stored alive in a wet chamber until evaluation.

FIG. 1.

Map of the Odessa region. (Black triangle) Location of Tr35 isolation (49°10′N, 30°47′E); (white triangle) location of Tr19 isolation (47°56′N, 29^°37′E).

Virus isolation and propagation

Virus isolation and propagation were performed using an in vivo method. Briefly, whole tick bodies were pooled and homogenized in Hanks' Buffered Salt Solution (HBSS) (Maniatis et al. 1982). This 10% tick suspension was centrifuged at 2000 rpm for 10 min, and 10–20 μL of the supernatant was inoculated into newborn white mice using the intracerebral route.

The inoculated mice were observed for 21 days. Mice with specific signs of neurotropic disorders (anorexia, flaccidity, paresis, plegia) were euthanized, and the brain was extracted. A 10% brain suspension was prepared and filtered through a 0.22-μm filter (Millipore) to exclude bacterial and protozoal agents, and a second inoculation was performed for virus propagation.

All of the procedures involving mice were performed with the approval of the institutional animal care and use committees.

Virus identification

Identification of the Tr35 and Tr19 strains was performed using the hemagglutination assay (HA) and the complement fixation test (CFT) using acetone-extracted antigen from the mouse brain, as described by Clarke and Casals (1958). Hemagglutination testing was performed at a range of pH values from 6.8 to 7.2 with goose, sheep, and human type O erythrocytes.

The CFT for identifying the Tr35 strain was performed using ascites fluids against KEMV, TRBV, Chenuda virus (CNUV), and Colorado tick fever virus (CTFV). Ascites fluids were produced from mouse ascites sarcoma 180/TG (Hermann and Engle 1958). Ascites fluid against the Tr35 strain was used as a positive control, and serum from an uninfected mouse was used as a negative control.

The CFT for identifying the Tr19 strain was performed using immune sera against TRBV (strain Tr35), Uukuniemi virus (UUKV), and tick-borne encephalitis virus (TBEV). Immune serum against the Tr19 strain was used as a positive control, and serum from an uninfected mouse was used as a negative control.

Ascites fluids and immune sera were titered from 1:8 to 1:256 with two-fold dilutions. The reactions were categorized as 0, 1, 2, 3, and 4, where 0=a complete lack of fixation (total hemolysis), 1=the majority of erythrocytes were hemolyzed (75% of erythrocytes), 2=a significant number of erythrocytes were hemolyzed (50% of erythrocytes), 3=a negligible number of erythrocytes were hemolyzed (25% of erythrocytes), and 4=complete fixation (absence of hemolysis). The CFT was considered positive when the score was 3 or 4.

Replication in cell lines

Replication of the Tr35 and Tr19 strains in various cell lines was tested using the Vero (African green monkey kidney cells), BHK-21 (Syrian hamster kidney fibroblast cells), and PEC (porcine embryonic cells) cell lines, which are most commonly used for arbovirus isolation. Cells were incubated at 37°C in a 5% CO₂ atmosphere. Throughout the testing period, the cells were monitored at 24-h intervals to estimate the cytopathic effect (CPE), a sign associated with infection (Li et al. 2014).

Detection of a lipid envelope

The presence or absence of a lipid envelope was established by evaluating the median lethal dose (LD_50/0.01mL) before and after ethyl ether treatment. Brain suspensions from infected mice with and without ethyl ether treatment were titered simultaneously with 10-fold dilutions, and the LD_50/0.01mL was evaluated using the procedure described by Reed and Muench (1938). A decrease in the LD_50/0.01mL value by several logarithms was the criterion for identifying susceptibility to ethyl ether treatment and, consequently, the presence of a lipid envelope (Klisenko 1986).

Electron microscopy

Brain suspensions were centrifuged at 4500 rpm for 30 min. The supernatants were pooled with an equal amount of homologous serum (diluted 1:10), incubated at 25°C for 2 h, and moved to 5°C for 18 h. After incubation, 1.5 mL of the mixture was centrifuged at 22,000 rpm at 10°C for 4 h. The supernatant was discarded, and the precipitate was dissolved in 150 μL of deionized RNase-free water (Qiagen).

Five microliters of this solution was absorbed onto a copper/carbon-coated grid (Mesh 400, Agar Scientific) for 1 h, stained with 2% ammonium molybdate (pH 5.1) for 20 s, rinsed in water, and dried prior to examination by electron microscopy using a JEM-100SX (Jeol) transmission electron microscope.

Nucleic acid extraction

Total nucleic acids were extracted and purified using the RIBO-prep DNA/RNA extraction kit (AmpliSens) according to the recommendations of the manufacturer. The DNA/RNA was eluted with 50 μL of RNase-free elution buffer (AmpliSens) and stored at −70°C.

Reverse transcription and amplification

Reverse transcription was performed using random hexanucleotide primers and the Reverta-L kit (AmpliSens) according to the manufacturer's recommendations. The cDNA was stored at −70°C and used as a template for amplification.

The full genomes of the Tr35 and Tr19 strains were sequenced (excluding the 5′ and 3′ ends of each segment). For this sequencing, a set of 26 primer pairs was used (Table 1). Primer design was based on the reference sequences for TRBV (HQ266581—HQ266590) (Dilcher et al. 2012). Overlapping fragments of the Tr35 and Tr19 genomes were amplified and sequenced. A hot-start amplification was performed in a 25-μL reaction containing 2 μL of cDNA, 1 μL of sense primer (10 pmol per μL), 1 μL of antisense primer (10 pmol/μL), 2.5 μL of dNTPs (1.76 mM, AmpliSens), and 10 μL of PCR buffer blue-2 (AmpliSens). The thermocycling parameters were set at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60–65°C for 20 s (depending on the primer pair), and 72°C for 30 s; a final elongation step was performed for 5 min. The reactions were performed in a MaxyGene gradient thermocycler (Axygen). The results of these amplification reactions were analyzed by 1.2% agarose gel electrophoresis containing ethidium bromide.

Table 1.

Primers Used for Sequencing

Primer	Sequence (5′-3′)	Segment	Position	Orientation
1-1f	TAAAATGTCATGGCTGTAGTGGAGC	1	2–26	Sense
1-1r	AGGGTTCCGTATGCGTTTCCAGC	1	855–877	Antisense
1-2f	TGAGGGCTAGCTATTCATGGTTTGTG	1	741–766	Sense
1-2r	TGTTGCGGCGCCAACACGTTTAC	1	1544–1566	Antisense
1-3f	AGTATACGACGCCGCAATGCTAC	1	1461–1483	Sense
1-3r	AGCCGTACATAGTGGAGAGTGTC	1	2261–2283	Antisense
1-4f	TCCAGCAGCCGGCAACCTTCG	1	2211–2231	Sense
1-4r	TCATCGTAGAGGAGAGTCTGTCG	1	3019–3041	Antisense
1-5f	TCACAGACCCTGACGTAGGTGC	1	2961–2982	Sense
1-5r	TATCCTTATGTCGGGCGGACGTTC	1	3868–3891	Antisense
2-1f	ACTTCCGGAAGCAATGGCGAATC	2	6–28	Sense
2-1r	AGCGGTCAACGCCTGATGGAC	2	673–693	Antisense
2-2f	TGAACCAAGATCAAGACGATGTACTG	2	605–630	Sense
2-2r	ATCGTCCGTCTGTCATCAGTTGC	2	1252–1274	Antisense
2-3f	ACACCGCCAGGTGCCTAGATC	2	1205–1255	Sense
2-3r	AGCGAAGCTCTCCGGATTGGC	2	1897–1917	Antisense
2-4f	TTATCAGCCAATTCTGGAATCCGTC	2	1812–1836	Sense
2-4r	ATCCTTACTCCGGGCCCATGC	2	2771–2791	Antisense
3-1f	TAAAATGTTCGGATCGCACACGATAC	3	2–27	Sense
3-1r	TATCGCTACGTACGTCCCACA	3	755–795	Antisense
3-2f	ATGACAACGTAATCGTTCGCAGGG	3	691–614	Sense
3-2r	AAGACGATCGCATAATTCGCGGC	3	1437–1459	Antisense
3-3f	TCCTGCTGTTGCTGATGCTGTTAG	3	1375–1398	Sense
3-3r	ATGTTATGTTCGCCTGACAGCACG	3	1910–1933	Antisense
4-1f	ATTTCCTTCTTCGTTCGTGGTCGC	4	7–30	Sense
4-1r	TTCCGGGTCACGCTGATATACG	4	573–594	Antisense
4-2f	TGAGATAATTGACTCAATCGCAATCGG	4	501–527	Sense
4-2r	AGCGGTCTCAGCGAACGAATCG	4	1103–1124	Antisense
4-3f	ACATGCCAGTCATGCTATGCCG	4	1012–1033	Sense
4-3r	ACAAATGTAGCGGACGATGGTCAG	4	1687–1710	Antisense
5-1f	TAAAATCTTGTTCGCCATGGAGG	5	2–24	Sense
5-1r	TGTACTTCCAGTAGGAGCGC	5	711–730	Antisense
5-2f	ACGTGAGACAAAACAGGCAGAC	5	541–562	Sense
5-2r	TGGCTGGATCCCAGATTACG	5	1305–1324	Antisense
5-3f	TTGAAGCAGGACCCGCTTTC	5	1252–1271	Sense
5-3r	TATCTTAGTCTTGCCCGCGG	5	1710–1729	Antisense
6-1f	TAAAAACTCTCACGCAACAGGC	6	2–23	Sense
6-1r	TCGATCTCTTTCAGATGACGTG	6	958–979	Antisense
6-2f	ACCGCCTCGGGAAAACGATCC	6	808–828	Sense
6-2r	TATCCTAACCCCATCGCAGGC	6	1647–1667	Antisense
7-1f	AAATCCTCATTTCGGACGAGCAGC	7	6–29	Sense
7-1r	TTGGGAATGGGGCTCAGCGTC	7	760–780	Antisense
7-2f	AGAATCCACGGAATCAGAAATAGCG	7	632–656	Sense
7-2r	TCTTAGAATCCCCCCTCCGCG	7	1173–1193	Antisense
8-1f	TAAAATTCTTCACCGACATGGACGCG	8	2–27	Sense
8-2r	ATGTCCGCTTCCATCGAATCATAGAC	8	799–824	Antisense
8-2f	TGGCGGAGTTCACATGGCAACG	8	572–593	Sense
8-2r	TCTTGAAGAGCCGGGTAACGCAC	8	1128–1150	Antisense
9-1f	AATTCCCTCGTCAGTACGGCAG	9	6–27	Sense
9-2r	CCCTGCGTACTGTCACCCTAT	9	1002–1022	Antisense
10-1f	TAAAAATTTCCCAACAATGCTAGCAG	10	2–27	Sense
10-1r	TATCTTAATTCCCCGGCGACAC	10	683–704	Antisense

f, forward; r, reverse.

In silico analysis

Fragments were sequenced using the Sanger method on an ABI-Prism 3500 XL device (Applied Biosystems). Genomes were assembled using Lasergene 7.0 software (DNASTAR, Inc.). For the phylogenetic analysis, the VP1–VP10 sequences of the Tr35 and Tr19 strains were compared with sequences from appropriate strains of the Orbivirus genus. The GenBank accession numbers are provided in Table 2. The sequence alignments were performed using the CLUSTAL W software program (Thompson et al. 1994). The phylogenetic analysis was performed using the MEGA 6.0 software program with the Jukes–Cantor substitution model and the neighbor-joining (NJ) tree algorithm (Jukes and Cantor 1969).

Table 2.

Virus Strains Used in This Study

N	Species/serotype	Abbreviation	Isolate/strain	GenBank accession no.
1	African_horse_sickness_virus_7	AHSV	—	JQ742006
2	African_horse_sickness_virus_1	AHSV	—	FJ011107
3	African_horse_sickness_virus_2	AHSV	HS_82/61	KF859996
4	African_horse_sickness_virus_6	AHSV	HS_39/63_1S	KF860006
5	African_horse_sickness_virus_8	AHSV	HS_10/62_2S	KF860026
6	African_horse_sickness_virus_9	AHSV	HS_90/61	KF860036
7	African_horse_sickness_virus_3	AHSV	RSArrah/03^*	KF446267
8	African_horse_sickness_virus_5	AHSV	RSArrah/05^*	KF446269
9	African_horse_sickness_virus_6	AHSV	RSArrah/06^*	KF446270
10	African_horse_sickness_virus_7	AHSV	KENrrah/07^*	KF446271
11	African_horse_sickness_virus_9	AHSV	PAKrrah/09^*	KF446273
12	Bluetongue_virus_1	BTV-1	Y863	KC879615
13	Bluetongue_virus_2	BTV-2	25036	JX272599
14	Bluetongue_virus_3	BTV-3	8231	JX272589
15	Bluetongue_virus_4	BTV-4	79043	JX272579
16	Bluetongue_virus_5	BTV-5	4868	JX272569
17	Bluetongue_virus_6	BTV-6	5011	JX272559
18	Bluetongue_virus_7	BTV-7	1504	JX272549
19	Bluetongue_virus_8	BTV-8	8438	JX272539
20	Bluetongue_virus_9	BTV-9	2766	JX272529
21	Bluetongue_virus_10	BTV-10	2627	JX272519
22	Bluetongue_virus_11	BTV-11	4574	JX272509
23	Bluetongue_virus_12	BTV-12	75005	JX272499
24	Bluetongue_virus_13	BTV-13	160	JX272489
25	Bluetongue_virus_14	BTV-14	BT87/59	JX272479
26	Bluetongue_virus_15	BTV-15	23/8/65	JX272469
27	Bluetongue_virus_16	BTV-16	7766	JX272459
28	Bluetongue_virus_17	BTV-17	S7668	JX272449
29	Bluetongue_virus_18	BTV-18	BT32/76	JX272439
30	Bluetongue_virus_19	BTV-19	25-2	JX272429
31	Bluetongue_virus_20	BTV-20	BT71/77	JX272419
32	Bluetongue_virus_21	BTV-21	CSIRO_154	JX272409
33	Bluetongue_virus_22	BTV-22	84/184	JX272389
34	Bluetongue_virus_23	BTV-23	5268/5	JX272399
35	Chuzan_virus (Kasba virus)	KASV	ref	NC_005990
36	Corriparta_virus	CORV	AUS1960/01	KC853042
37	Changuinola_virus	CGLV	BE_AR_490492	JQ610655
38	Changuinola_virus	CGLV	BE_AN_28873	NC_022639
39	Changuinola_virus	CGLV	BE_AR_397956	KF668547
40	Changuinola_virus	CGLV	BE_AR_425269	KF668557
41	Changuinola_virus	CGLV	BE_AR_41067	KF680178
42	Changuinola_virus	CGLV	BE_AR_385199	KF680188
43	Changuinola_virus	CGLV	BE_AR_440541	KF690581
44	Changuinola_virus	CGLV	BE_AR_54342	KF690591
45	Changuinola_virus	CGLV	BE_AR_385278	KF690601
46	Changuinola_virus	CGLV	BE_AR_434080	KF690611
47	Changuinola_virus	CGLV	BE_AR_478620	KF690621
48	Epizootic_hemorrhagic_disease_virus_1	EHDV	IbAr22619	AM745007
49	Epizootic_hemorrhagic_disease_virus_2	EHDV	Ibaraki	AM745077
50	Epizootic_hemorrhagic_disease_virus_4	EHDV	IbAr_33853	AM745017
51	Epizootic_hemorrhagic_disease_virus_5	EHDV	CSIRO_157	AM745027
52	Epizootic_hemorrhagic_disease_virus_6	EHDV	M44/96	HM636907
53	Epizootic_hemorrhagic_disease_virus_6	EHDV	318	AM745067
54	Epizootic_hemorrhagic_disease_virus_7	EHDV	CSIRO_775	AM745047
55	Epizootic_hemorrhagic_disease_virus_8	EHDV	CPR_3961A	AM745057
56	Equine_encephalosis_virus_6	EEV	Potchefstroom	HQ630892
57	Equine_encephalosis_virus_4	EEV	Bryanston	HQ630902
58	Equine_encephalosis_virus_1	EEV	Cascara	HQ630912
59	Equine_encephalosis_virus_2	EEV	Gamil	HQ630922
60	Equine_encephalosis_virus_3	EEV	Kaalplaas	HQ630932
61	Equine_encephalosis_virus_7	EEV	Northrand	HQ630952
62	Equine_encephalosis_virus	EEV	Kimron1	AB811635
63	Eubenangee_virus	EUBV	AUS1963/01	JQ070376
64	Great_Island_virus	GIV	CanAr 42	NC_014522 - NC_014531
65	Kemerovo_virus	KEMV	ref	HQ266591 - HQ266600
66	Kemerovo_virus	KEMV	21/10	KC288130 - KC288139
67	Lebombo_virus	LEBV	SAAR_3896	JQ610665
68	Lipovnik_virus	LIPV	CzArLip_91	HM543475 - HM543477
69	Mobuck_virus	MPOV	12-2	NC_022626
70	Okhotskiy_virus	OKHV	LEIV-70C	KF981625
71	Orungo_virus	ORUV	UGMP_359	JQ610675
72	Peruvian_horse_sickness_virus	PHSV		DQ248057
73	Pata_virus	PATAV	CAF1968/01	JQ070386
74	Sathuvachari_virus	SVIV	An66411	KC432629
75	Stretch_Lagoon_orbivirus	SLOV	ref	NC_012754
76	Tibet_orbivirus	TIBOV	XZ0906	KF746187
77	Tilligerry_virus	TILV	AUS1978/03	JQ070366
78	Tribec_virus	TRBV	ref	HQ266581 - HQ266590
79	Tribec_virus	TRBV	Tr19	KJ010789- KJ010789, KJ574045
80	Tribec_virus	TRBV	Tr35	KJ010798 - KJ010806, KJ574044
81	Umatilla_virus	UMAV	USA1969/01	HQ842619
82	Yunnan_orbivirus	YUOV	YOV-77-2	AY701509

Results

Virus identification

HA testing of the strains Tr35 and Tr19 resulted in a lack of hemagglutination with goose, sheep, and human type O erythrocytes over a pH range from 6.8 to 7.2. The results of the CFT for strain Tr35 are presented in Table 3. Acetone-extracted antigen from strain Tr35 was able to form immune complexes with antibodies against TRBV and KEMV (both viruses are members of the Orbivirus genus, Kemerovo serogroup). This resulted in strong complement-fixing activity, especially for the TRBV-antibody/strain-Tr35-antigen complex (1:64) and the strain-Tr35-antibody/Tr35-antigen complex (1:64). The complement-fixing activity for the KEMV-antibody/strain-Tr35-antigen complex was 1:32. The ability to form immune complexes with CNUV (a member of the genus Orbivirus, Chenuda serogroup) and CTFV (a member of the genus Coltivirus, Colorado tick fever serogroup) was not observed, and complexes were not observed with uninfected serum (complete lack of complement fixation). Therefore, strain Tr35 was identified as TRBV.

Table 3.

CFT Results for Strain Tr35

		Acetone-extracted antigen, strain Tr35 (1:10)
Immune ascites fluid		Complement portion
Virus	Dilution	I	II	III
Kemerovo virus (KEMV)	1:8	4	4	4
	1:16	4	4	4
	1:32	3	2	3
	1:64	2	0	0
	1:128	2	1	0
	1:256	2	0	0
Tribeč virus (TRBV)	1:8	4	4	4
	1:16	4	4	4
	1:32	4	3	3
	1:64	3	2	1
	1:128	2	1	0
	1:256	1	0	0
Strain Tr35 (K+)	1:8	4	4	4
	1:16	4	4	4
	1:32	4	4	4
	1:64	3	1	0
	1:128	0	0	0
	1:256	0	0	0
Chenuda (CNUV)	1:8	0	0	0
	1:16	0	0	0
	1:32	0	0	0
	1:64	0	0	0
	1:128	0	0	0
	1:256	0	0	0
Colorado tick fever virus (CTFV)	1:8	0	0	0
	1:16	0	0	0
	1:32	0	0	0
	1:64	0	0	0
	1:128	0	0	0
	1:256	0	0	0
Serum from an uninfected mouse (K−)	1:8	0	0	0
	1:16	0	0	0
	1:32	0	0	0
	1:64	0	0	0
	1:128	0	0	0
	1:256	0	0	0

The results of the CFT for strain Tr19 are presented in Table 4. The complement-fixing activity for the TRBV-Tr35-antibody/Tr19-antigen complex was 1:8; the activity for the TRBV-Tr35-antibody/TRBV-Tr-35-antigen was 1:16. The complement-fixing activities of the TRBV-Tr19-antibody/TRBV-Tr-35-antigen and TRBV-Tr19-antibody/TRBV-Tr-19-antigen complexes were 1:64. The ability to form immune complexes with UUKV (a member of the genus Phlebovirus, family Bunyaviridae) and TBEV (a member of the genus Flavivirus, family Flaviviridae) was not observed, and complexes were not observed with serum from an uninfected mouse. Therefore, strain Tr19 was also identified as TRBV.

Table 4.

CFT Results for Strain Tr19

		Acetone-extracted antigen (1:10)
		Strain Tr35			Strain Tr19
Immune sera		Complement portion
Virus	Dilution	I	II	III	I	II	III
Strain Tr35	1:8	4	4	4	3	3	4
	1:16	3	3	3	2	2	2
	1:32	2	2	2	1	1	1
	1:64	1	1	1	1	1	1
Strain Tr19 (K+)	1:8	4	4	4	4	4	4
	1:16	4	4	4	4	4	4
	1:32	3	3	3	2	3	4
	1:64	3	2	2	1	4	2
Uukuniemi (UUKV)	1:8	0	0	0	0	0	0
	1:16	0	0	0	0	0	0
	1:32	0	0	0	0	0	0
	1:64	0	0	0	0	0	0
Tick-borne encephalitis virus (TBEV)	1:8	0	0	0	0	0	0
	1:16	0	0	0	0	0	0
	1:32	0	0	0	0	0	0
	1:64	0	0	0	0	0	0
Serum from an uninfected mouse (K−)	1:8	0	0	0	0	0	0
	1:16	0	0	0	0	0	0
	1:32	0	0	0	0	0	0
	1:64	0	0	0	0	0	0

Replication in cell lines

A CPE was observed after 2 days of replication in the BHK-21 line and after 3 days in the PEC and Vero lines.

Detection of a lipid envelope

Comparative evaluations of the LD_50/0.01mL for the strains Tr35 and Tr19 showed susceptibility to ethyl ether treatment. According to our data, the LD_50/0.01mL for strain Tr35 was 6.2 logs before treatment and 5.0 logs after treatment, whereas the LD_50/0.01mL for strain Tr19 was 7.0 logs before treatment and 5.2 logs after treatment. Therefore, there was a 1.2-log reduction in the LD_50/0.01mL for strain Tr35 and a 1.8-log reduction in the LD_50/0.01mL for strain Tr19. These data confirmed the absence of a lipid envelope in both strains.

Electron microscopy

The virus particles were approximately 70 μm with a defined surface structure containing ring-shaped capsomeres (see Fig. 2). This structure is consistent with viruses of the genus Orbivirus within the family Reoviridae (Mertens et al. 2000).

FIG. 2.

Electron micrograph of virus particles. The size of particles is approximately 70 μm.

Phylogenetic analysis

The phylogenetic analysis of the VP1–VP10 nucleotide sequences of the Tr35 and Tr19 strains, along with the appropriate sequences of other orbiviruses, confirmed their classification in the genus Orbivirus (Figs. 3 and 4). The location of Tr35 and Tr19 on the phylogenetic trees indicates their membership in the GIV subgroup and a close relationship with the TRBV that was sequenced previously (Dilcher et al. 2012), as well as with LIPV and KEMV. The pairwise comparison of the VP1 sequences within the GIV subgroup demonstrated that Tr35 and Tr19 share 89% nucleotide identity with each other. Strain Tr35 shares 94% identity with the reference strain TRBV, whereas strain Tr19 shares 90% identity with the reference strain. Strain Tr35 shared 94% identity with LIPV, whereas strain Tr19 was 89% identical to LIPV. For both the Tr35 and Tr19 strains, the shared identities with the reference strain KEMV, strain KEMV-21/10 and GIV were 70%, 71% and 68%, respectively (see Table 5).

FIG. 3.

Phylogenetic tree of the Orbivirus genus based on VP1 gene sequences (nucleotide level). The phylogenetic analysis was performed using the Jukes–Cantor substitution model, and the trees were reconstructed using the neighbor-joining (NJ) method in the MEGA 6.0 software. The statistical significance of the tree topology was evaluated by bootstrap resampling of the sequences 1000 times. The locations of the Tr35 and Tr19 strains are marked with black dots on the tree. BTV, bluetongue virus; EHDV, epizootic hemorrhagic disease virus; PATAV, Pata virus; TIBOV, Tibet orbivirus; EUBV, Eubenangee virus; TILV, Tilligerry virus; CGLV, Changuinola virus; LEBV, Lebombo virus; EEV, equine encephalosis virus; ORUV, Orungo virus; KASV, Kasba virus; AHSV, African horse sickness virus; YUOV, Yunnan virus; MPOV, Mobuck virus; PHSV, Peruvian horse sickness virus; SVIV, Sathuvachari virus; CORV, Corriparta virus; UMAV, Umatilla virus; SLOV, Stretch Lagoon orbivirus; OKHV, Okhotskiy virus; GIV, Great Island virus; KEMV, Kemerovo virus; TRBV, Tribeč virus; LIPV, Lipovnik virus.

FIG. 4.

Phylogenetic tree of the Great Island virus (GIV) subgroup based on VP1–VP10 gene sequences (nucleotide level). The phylogenetic analysis was performed using the Jukes–Cantor substitution model, and trees were reconstructed using the neighbor-joining (NJ) method and MEGA 6.0 software. The trees were rooted using the appropriate sequences of the GIV segments, and the GIV branches were deleted from the trees. The statistical significance of the tree topology was evaluated by bootstrap resampling of the sequences 1000 times. The locations of the Tr35 and Tr19 strains are marked with black dots on the trees. LIPV, Lipovnik virus; TRBV, Tribeč virus; KEMV, Kemerovo virus.

Table 5.

Nucleotide Identities of the VP1 and VP3 Sequences Within the Great Island Virus Subgroup

	VP1 (RdRp)	VP3 (T2)	VP1 nucleotide identity, %		VP3 nucleotide identity, %
Species/strain	GenBank accession no.	GenBank accession no.	Strain Tr35	Strain Tr19	Strain Tr35	Strain Tr19
TRBV_ref	HQ266581.1	HQ266582.1	94	90	95	95
TRBV_Tr35	KJ010806.1	KJ010805.1	—	89	—	99
TRBV_Tr19	KJ010797.1	KJ010796.1	89	—	99	—
LIPV_CzArLip_91	HM543475.1	HM543476.1	94	89	93	93
KEMV_21/10	KC288130.1	KC288131.1	71	71	76	76
KEMV ref	HQ266591.1	HQ266592.1	70	70	76	76
GIV	NC_014522	NC_014524	68	68	73	73

TRBV, Tribeč virus; LIPV, Lipovnik virus; KEMV, Kemerovo virus; GIV, Great Island virus.

Comparisons of the VP3 sequences demonstrated a 99% nucleotide identity between strains Tr35 and Tr19 and a 95% identity between the Tr35 and Tr19 strains and the reference sequence of TRBV. The shared identities with the sequences of LIPV, KEMV, and GIV were 93%, 76%, and 73%, respectively.

Phylogenetic trees for different genomic segments revealed distinct phylogenetic relations among TRBV-ref, Tr19, and Tr35 strains. In segments 1, 3, 4, 6, and 7, the Tr19 strain was an outgroup to the reliably supported group of TRBV-ref and Tr35 strains. In segments 2, 5, 8, and 10, TRBV-ref was an outgroup to the reliably supported group of Tr19 and Tr35. In segment 9, the Tr35 strain was an outgroup to TRBV-ref and Tr19 strains. Moreover, different phylogenetic positions of the LIPV strain sequences were observed within the GIV subgroup. LIPV was an outgroup to the three TRBV sequences in segments 2 and 6, but grouped reliably with TRBV in segment 1. Unfortunately, we could not extend this observation to other genome segments, because there was only sequence of three genome regions available in GenBank.

Discussion

Here we report the isolation and characterization of two strains of TRBV isolated in Ukraine in 1988 and 2008. The affiliation of both strains with the genus Orbivirus within the Reoviridae family was confirmed using CFT, electronic microscopy, and molecular methods. In addition, CFT demonstrated the presence of cross-reactivity with ascites fluid against KEMV, a virus closely related to TRBV, and the absence of cross-reactivity with ascites fluid against CNUV and CTFV, as well as with sera against TBEV and UUKV. The electron microscopy study demonstrated viral particles with shapes and sizes distinctive for orbiviruses.

HA testing of strains Tr35 and Tr19 showed a lack of hemagglutination with goose, sheep, and human type O erythrocytes. Thus, HA testing could not be used for diagnostic testing of TRBV (Hubálek and Rudolf 2012). Susceptibility to treatment with ethyl ether confirmed the absence of a lipid envelope, which is typical for Reoviridae (Mertens et al. 2000). The two strains demonstrated the ability to replicate in BHK-21, PEC, and Vero cell lines. During replication in the BHK-21 line, a CPE was observed slightly earlier than in the PEC and Vero lines.

Full genomes of the Tr35 and Tr19 strains were sequenced (excluding the 5′ and 3′ ends of each segment) and submitted to GenBank under the accession numbers KJ574044–KJ574045 and KJ010789–KJ010806. The phylogenetic analysis demonstrated the close relationships of Tr35 and Tr19 with the reference TRBV strain. According to the Ninth Report of the International Committee on Taxonomy of Viruses, a species demarcation criterion in the genus Orbivirus is less than 74% identity among the VP3 nucleotide sequences (King et al. 2012). An analysis of the sequence identities for TRBV, KEMV-ref, KEMV-21/10, LIPV, strain Tr35, and strain Tr19 demonstrated that the identities ranged from 76% to 95% (Table 5). Therefore, all of these strains should be considered members of one species according to current criteria. Phylogenetic analysis revealed distinct and reliably supported grouping patterns among TRBV and LIPV in different genome segments. This indicates that segment reassortment was common in TRBV, and supports assignment of LIPV to TRBV, because their genome segments were genetically compatible and could be involved in reassortment. No phylogenetic evidence of reassortment between TRBV and KEMV was observed. The sample of five genomic sequences does not allow such reassortment to be completely ruled out, but if future studies do not reveal reassortment between KEMV and TRBV, this would speak for acknowledging them as distinct taxonomic entities.

For a more detailed understanding of the complicated phylogeny within the GIV subgroup, epidemiological studies are needed, and additional isolates of TRBV and KEMV should be analyzed.

Footnotes

Acknowledgments

This work was supported by the Russian Federal Target Program “National system of chemical and biological safety of the Russian Federation (2009–2013)” (project no. 60-D 17072012). The authors express deep gratitude to D.K. Lvov, the head of the D.I. Ivanovsky Institute of Virology, for his assistance in confirming the identification of strain Tr35.

Author Disclosure Statement

No competing financial interests exist.

References

Belaganahalli

, Maan

, Tesh

, et al. Umatilla virus genome sequencing and phylogenetic analysis: Identification of stretch lagoon orbivirus as a new member of the umatilla virus species. PLoS One, 2011; 6:e23605.

Belaganahalli

, Maan

, Nomikou

, et al. Full genome sequencing and genetic characterization of Eubenangee viruses identify Pata virus as a distinct species within the genus Orbivirus. PLoS One, 2012; 7:e31911.

Belhouchet

, Mohd Jaafar

, Tesh

, Grimes

, et al. Complete sequence of Great Island virus and comparison with the T2 and outer-capsid proteins of Kemerovo, Lipovnik and Tribeč viruses. J Gen Virol, 2010; 91:2985–2993.

Chumakov

, Ernek

, Kozuch

, Sarmanov

, et al. Report on Isolation from Ixodes persulcatus ticks and from patients in Western Siberia of a virus differing from agent of tick-borne encephalitis. Acta Virol, 1963; 7:82–83.

Clarke

, Casals

. Techniques for hemagglutination and hemagglutination inhibition with arthropod-borne viruses. Am J Trop Med Hyg, 1958; 7:561–573.

Cooper

, Anbalagan

, Klumper

, Scherba

, et al. Mobuck virus genome sequence and phylogenetic analysis: Identification of a novel Orbivirus isolated from a white-tailed deer in Missouri, USA. J Gen Virol, 2014; 95:110–116.

Cowled

, Palacios

, Melville

, Weir

, et al. Genetic and epidemiological characterization of Stretch Lagoon orbivirus, a novel orbivirus isolated from Culex and Aedes mosquitoes in northern Australia. J Gen Virol, 2009; 90:1433–1439.

Dilcher

, Hasib

, Lechner

, Wieseke

, et al. Genetic characterization of Tribeč virus and Kemerovo virus, two tick-transmitted human-pathogenic orbiviruses. Virology, 2012; 423:68–76.

Filippova

. Ixodid Ticks of the Subfamily Ixodinae. Fauna of the USSR: Arachnoides, vol. 4(4). Leningrad: Nauka, 1977. [In Russian]

10.

Hermann

, Engle

. Tumor cell-induced mouse ascites fluid as a source of viral antibodies. Exp Biol Med, 1958; 98:257–259.

11.

Hubálek

, Rudolf

. Tick-borne viruses in Europe. Parasitol Res, 2012; 111:9–36.

12.

Jukes

, Cantor

. Evolution of Protein Molecules. Academic Press, 1969:21–132.

13.

Kapoor

, Tesh

, Duraisamy

, Popov

, et al. A novel mosquito-borne Orbivirus species found in South-east Asia. J Gen Virol, 2013; 94:1051–1057.

14.

King

AMQ

, Adams

, Carstens

, Lefkowitz

. Virus Taxonomy, Classification and Nomenclature of Viruses, Ninth Report of the International Committee on Taxonomy of Viruses, vol. 9. Elsevier, 2012.

15.

Klisenko

. Nonserological methods on arbovirus identification. Arboviruses. Thesis of Medical Academy of USSR, Moscow, 1986:161–163. [In Russian]

16.

, Zheng

, Zhao

, Fu

, Wang

, et al. Tibet Orbivirus, a novel Orbivirus species isolated from Anopheles maculatus mosquitoes in Tibet, China. PLoS One, 2014; 9:e88738.

17.

Libikova

, Rehacek

, Somogyio

. Viruses related to Kemerovo virus in Ixodes ricinus ticks in Czechoslovakia. Acta Virol, 1965; 9:76–82.

18.

Maniatis

, Fritsch

, Sambrook

. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982.

19.

Mertens

PPC

, et al. Virus taxonomy. In: van Regenmortel

MHV

, Fauquet

, et al. Proceedings of the Seventh Report of the International Committee for the Taxonomy of Viruses. San Diego: Academic Press, New York, 2000.

20.

Reed

, Muench

. A simple method of estimation of fifty percent endpoints. American J Hyg, 1938; 27:493–497.

21.

Thompson

, Higgins

, Gibson

. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 1994; 22:4673–4680.