Assessment of Prevalence and Distribution of Spotted Fever Group Rickettsiae in Manitoba,Canada,in the American Dog Tick,Dermacentor variabilis (Acari: Ixodidae)

Abstract

Little is known about the distribution and prevalence of the spotted fever group rickettsiae in Canada. We conducted active surveillance for tick-associated rickettsiae in 10 localities in Manitoba. A total of 1044 adult American dog ticks, Dermacentor variabilis (Acari: Ixodidae), were collected and screened for spotted fever group rickettsiae. Rickettsia montanensis was the only species of rickettsia detected. The mean prevalence of infection was 9.8% (range, 0.00–21.74% among localities). The proportion of infected male and female ticks was not significantly different; however, tick populations near the northern limit of D. variabilis distribution in Manitoba had a lower prevalence of infection compared to tick populations from more southern localities in the province.

Introduction

R ickettsia is a genus of small, Gram-negative alphaproteobacteria, all species of which are obligatory intracellular parasites. Rickettsiae, including the spotted fever group rickettsiae (SFGR), are vector-borne bacteria, some of which are of significant human and animal pathogens (Burgdorfer and Anacker 1981, Azad and Beard 1998, Raoult and Parola 2007). Rickettsioses have recently gained the attention of physicians as important emerging diseases in North America and around the world (Wood and Artsob 2012). Numerous factors contribute to this. Humans are encroaching into areas where SFGR are enzootic and are being exposed (Wood and Artsob 2012). Humans are also altering the landscape for agricultural development, causing movement and population fluctuations of hosts and altering the potential range of the tick and pathogens (Tabachnick 2010, Dergousoff et al. 2013). Range expansion of the SFGR is also attributed to the increase in the range of the tick vectors.

Dispersal of Dermacentor ticks, vectors of SFGR in Canada, is chiefly accomplished by the movements of large mammal hosts infested with adult ticks (Wilkinson 1967, Dergousoff et al. 2013). Additionally, abiotic factors caused by changing climate may facilitate a change of prevalence and geographic distribution of SFGR by altering survivorship and population density of vectors and hosts involved in the disease cycle (Tabachnick 2010). Establishing a baseline for any potential pathogen, whether endemic or emerging, serves an important role in public health and conservation and for future epidemiological studies.

The genus Rickettsia can be separated into two main groups, the typhus group and the SFG rickettsiae. Typhus group rickettsiae can cause typhus in humans, are insect (lice and flea) vectored, and cannot enter the nucleus of infected cells. In contrast, the SFGR can cause spotted fever in humans, are tick vectored with few exceptions, and have the capability to enter the nuclei of infected cells. The SFGR consist of more than 20 species, and many are confirmed human pathogens (Wood and Artsob 2012). Other members of the SFGR are implicated in emerging disease or have unknown pathogenicity. These rickettsiae still play an important role by interfering with transmission of other more pathogenic SFGR (Burgdorfer et al. 1966, Azad and Beard 1998, Niebylski et al. 1999, Randolph 2004, Wood and Artsob 2012). This group of rickettsiae is transmitted by a variety of species of hard ticks (Acari: Ixodidae). In North America, this includes ticks of many genera, such as Haemaphysalis, Rhipicephalus, Amblyomma, and Dermacentor. The SFGR of greatest public health concern is Rickettsia rickettsii, the causative agent of Rocky Mountain spotted fever.

Additional complications must be considered when examining the ecology of SFGR in comparison to other tick-borne agents. Presence or absence of one species of SFGR in a geographic area may greatly impact the ecology of another. For example, R. rickettsii is a highly pathogenic SFGR that causes higher levels of morbidity to infected vertebrate hosts and tick vectors (Burgdorfer and Anacker 1981, Azad and Beard 1998, Niebylski et al. 1999, Raoult and Parola 2007, Wood and Artsob 2012). This species also appears to have higher prevalence of infection in areas where it is the only endemic Rickettsia (Wood and Artsob 2012). These facts alone could limit the population of hosts and vectors, reducing the possibility of transmission of other less prevalent species (Niebylski et al. 1999). However, in locations in North America where less pathogenic or nonpathogenic SFGR are present, such as Rickettsia peacockii, there appears to be an absence or very low prevalence of R. rickettsii (Burgdorfer et al. 1966, Azad and Beard 1998, Niebylski et al. 1999, Wood and Artsob 2012). This phenomenon can be explained by at least two possibilities. Naïve hosts may be exposed to the less pathogenic SFGR and develop a sufficient immune response to prevent future transmission of R. rickettsii. Additionally, competitive exclusion has been observed among the SFGR. This means that ticks that are previously infected with some species of SFGR are rarely superinfected with R. rickettsii (Niebylski et al. 1999, Macaluso et al. 2002).

A lower prevalence of human cases of rickettsioses has been reported in Canada compared to the United States (Dergousoff et al. 2009, Wood and Artsob 2012). Additionally, there are few published data on the presence of SFGR and cases of rickettsioses in Canada, even though the primary vector species are present and abundant (Gregson 1956, Wilkinson 1967, Wood and Artsob 2012). Recently, the number of human and domestic animal cases of diseases caused by a wide array of tick-borne pathogens has increased (Wood and Artsob 2012). This is attributed to range expansion of tick populations, changes in landscape and climate, and more accurate diagnostic testing (Randolph 2004, Ogden et al. 2007, 2008a, 2008b, Tabachnick 2010, Wood and Artsob 2012). Manitoba offers ideal habitat for a variety of rodent hosts that can harbor rickettsiae, especially the suspected main amplifying host, the meadow vole, Microtus pennsylvanicus (Ord) (Reich 1981, Wood and Artsob 2012). Southern Manitoba is also within the northern limit of the range of the American dog tick, Dermacentor variabilis (Say), an important vector of SFGR in North America, including R. rickettsii (Wood and Artsob 2012). Little work has been conducted exploring the distribution and prevalence of SFGR in Canada, especially in Manitoba (Dergousoff et al. 2009). All ecological components appear to be in place to allow for the transmission and maintenance of these organisms.

The range of D. variabilis in Manitoba has, in recent history, expanded northward, encroaching into the boreal region of the province (Dergousoff et al. 2013). These newly established populations may have different profiles of infection by various Rickettsia spp. when compared to southern tick populations that have been endemic and potentially infected for a much longer period of time. The objective of this study was to establish what rickettsial agents are present in American dog ticks in Manitoba and if prevalence of infection varies among tick populations from different geographic regions.

Materials and Methods

Host-seeking ticks were collected from crown land, provincial parks, and private property by drag sampling. In all, 1044 adult American dog ticks were collected from 10 different localities from across the province (Fig. 1, Table 1). Drag sampling was performed from April to August at all localities in 2012 and preliminary sampling was also conducted from one locality (Arbakka) in 2011. The coordinates of each collection locality were recorded using a hand held GPS unit (GPSMAP60^®CSX, Garmin).

FIG. 1.

Map of Manitoba, Canada. The numbers signify approximate locations where American dog ticks, Dermacentor variabilis, were collected (Table 1); the star signifies the provincial capital, Winnipeg. The dark line is the historical northern distribution limit of D. variabilis modified from Wilkinson (1967) and Dergousoff et al. (2013).

Table 1.

List of Localities with Coordinates for Collections of Dermacentor variabilis along with Numbers of Ticks Collected at Each Site and the Number Infected with the Spotted Fever Group Rickettsia, Rickettsia montanensis

			Numbers of ticks tested for SFGR			Numbers of ticks infected with SFGR
Localities	Site number	GPS co-ordinates	Males	Females	Total	Males	Female	Total	Prevalence %
Nopiming Provincial Park	6	50°46.103N 095°18.020W	92	90	182	0	0	0	0.0^a
Porcupine Provincial Forest	1	52°27.172N 101°07.480W	23	19	42	0	0	0	0.0^ab
Ethelbert	2	51°33.463N 100°22.189W	47	45	92	0	3	3	3.3^b
Sandy Hook	8	50°33.178N 097°00.790W	47	45	92	0	3	3	3.3^b
Venlaw	4	51°18.067N 100°26.284W	47	45	92	2	4	6	6.5^bc
Homebrook	3	51°44.423N 098°46.261W	47	45	92	2	6	8	8.7^bcd
Dunrea	10	49°255.34N 099°4334.74W	40	44	84	10	3	13	15.5^cde
Libau	7	50°20.790N 096°42.189W	47	45	92	6	9	15	16.3^cde
Eriksdale	5	50°51.271N 097°57.849W	47	45	92	3	14	17	18.5^de
Arbakka 2011	9	49°03.237N 096°28.648W	47	45	92	10	8	18	19.6^e
Arbakka 2012	9	49°03.237N 096°28.648W	47	45	92	8	12	20	21.7^e
Total			531	513	1044	41	62	103	9.9

Site numbers correspond with localities indicated on Fig. 1. All sites were sampled in 2012, with the exception of Arbakka, where ticks were collected in 2011 and 2012. Values for the prevalence of infection with the same superscript are not significantly different (P ≤0.05).

To prevent contamination and enhance downstream reactions, the exteriors of the ticks were washed in four solutions. The first solution consisted of one drop of Tween^® 80 per 10 mL of 0.5% bleach. The second solution was 0.5% benzalkonium chloride, and the third solution was 70% ethanol. The final solution was purified water. Ticks were washed in 1 mL of each solution for 3 min per solution. After the ticks were disinfected and allowed to dry, they were sorted by sex and location of collection before being stored at −80°C. Whole DNA extractions were made using individual ticks using the blood and tissue protocol for the DNeasy^® (Qiagen) extraction kit. All molecular work was conducted at the National Microbiology Laboratory in Winnipeg, Manitoba, Canada. Voucher specimens of ticks were deposited the J.B. Wallis/R.E. Roughley Museum of Entomology in the Department of Entomology, University of Manitoba, Winnipeg, Manitoba, Canada.

Tick extractions were screened for SFGR using a ViaXII^™ (Applied Biosystems) real-time polymerase chain reaction (PCR) system. Two assays using different primers and probes were conducted, primer probe set CS (Stenos et al. 2005) and PanRick (Wölfel et al. 2008) (Table 2), each targeting separate sections of the gene gltA. DNA extracts that were reactive on both the CS and PanRick primer and probe sets were considered positive. Both reactions followed the same protocol and thermocycling conditions. Final reaction volume for the reactions was 25 μL. Forward and reverse primers (Table 2) had a reaction volume of 0.75 μL each with a reaction concentration of 0.3 μM. The probes (Table 2) had a reaction volume of 0.25 μL at a reaction concentration of 0.1 μM. Each reaction also contained 12.5 μL of TaqMan^® Universal MasterMix (Applied Biosystems), 5 μL of DNA extract, and 5.75 μL of nuclease-free water. Thermocycling consisted of a 15-min denaturation at 95°C and 40 cycles of 95°C, 55°C, and 72°C for 15, 30, and 30 s, respectively. Samples that screened positive in both assays were subjected to a conventional PCR assay to produce an amplicon that was submitted for sequencing.

Table 2.

List of Sequences, 5′ to 3′, of Primers and Probes, with Dye and Quencher, Used in the Real-Time and Conventional PCR Assays for Detection and Sequencing of Spotted Fever Group Rickettsiae

Primer set name with target gene	Source	Forward primer	Reverse primer	Probe
CS (gltA)	(Stenos et al. 2005)	TCGCAAATGTTCACGGTACTTT	TCGTGCATTTCTTTCCATTGTG	FAM-TGCAATAGCAAGAACCGTAGGCTGGATG-Tamra
PanRick (gltA)	(Wölfel et al. 2008)	ATAGGACAACCGTTTATTT	CAAACATCATATGCAGAAA	FAM-CCTGATAATTCGTTAGATTTTACCG-Tamra
Rr190.70p-Rr190.602n (OmpA)	(Regnery et al. 1991)	ATGGCGAATATTTCTCCAAAA	AGTGCAGCATTCGCTCCCCCT	NA

DNA collected from whole DNA exactions from tick tissue.

The conventional PCR targeted a portion of the gene responsible for coding for an outer membrane protein, OmpA, a protein that is species specific among the SFGR and is widely used for Rickettsia identification and phylogenetic studies (Roux et al. 1996). Each reaction had a final volume of 50 μL and consisted of 5 μL of forward and reverse primers (Table 2), each with a reaction concentration of 1 μM, 25 μL of HotStarTaq Master Mix^® (Qiagen) and 13 μL of nuclease-free water. The thermocycling conditions consisted of a 15-min denaturation at 95°C, followed by 40 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min. A final extension stage of 72°C for 10 min followed the cycling. This amplicon was sequenced at the National Microbiology Laboratory using the primer set Rr190.70p–Rr190.602n (Table 2) used in the amplification. For all PCR assays conducted, negative controls consisted of reactions that contained all reagents but contained no template, whereas the positive controls contained DNA extract of Rickettsia sibirica.

Sequences were aligned and edited using Geneious software's Geneious Aligner (Biomatters Limited). The National Center for Biotechnology Information Basic Local Alignment Search Tool was used to compare the aligned nucleotide sequences with sequences published in GenBank^®. The accession number and identification of the search result with the highest degree of similarity to each sequence were recorded.

Statistical comparison of prevalence of infection among localities was done using the Fisher exact test with the software Quantitative Parasitology 3.0 (Rózsa et al. 2000 ).

Results

The only species of tick collected was D. variabilis. In total, 1044 adult ticks were collected (531 males and 513 females) from all localities sampled in Manitoba. Collections consisted of 88–182 ticks in each locality, with a mean of 95 ticks per locality.

Overall 9.87% of the ticks (41 males and 62 females) tested positive for the presence of SFGR DNA. Negative and positive controls performed as expected. Although more female ticks were infected, this result was not significant (p=0.1813) on the basis of a log likelihood ratio test with Williams correction (Sokal and Rohlf 1995). All infected ticks were infected with one Rickettsia, Rickettsia montanensis. This was confirmed by a complete match of the approximately 500-bp amplicon sequences to a section of the complete genome of R. montanensis strain OSU 85-930 (acc. no. AY543682). The prevalence of infection ranged from 0.0% to 21.7% among the localities (Table 1). Spotted fever group rickettsiae were not detected in American dog ticks from only two localities, Porcupine Provincial Forest (n=42) and Nopiming Provincial Park (n=182).

Discussion

The fact that D. variabilis was the only tick infected with SFGR in this study is not surprising. The blacklegged tick, Ixodes scapularis Say, and several other Ixodes spp. are present in the province at lower densities than American dog ticks, but are not infected with SFGR (Krakowetz et al. 2011). The winter tick, Dermacentor albipictus (Packard), and the rabbit tick, Haemaphysalis leporispalustris (Packard) are also present in the province (Gregson 1956) and are known vectors of some Rickettsia spp.; however, because of their life history traits and behavior, adult ticks are uncommonly collected by drag sampling (Gregson 1956). Also, they seldom feed on human hosts (Philip and Kohls 1951, Freitas et al. 2009). There are no published records for the collection of the Rocky Mountain wood tick, Dermacentor andersoni Stiles, in Manitoba and none were collected. This tick's known range extends from central Saskatchewan west to British Columbia (Gregson 1956, Dergousoff et al. 2013). Absence of this tick may explain the absence of R. peacockii, because this bacterium appears to have a high degree of vector specificity, even in areas where the two tick populations overlap (Dergousoff et al. 2009). The pathogenic R. rickettsii, and nonpathogenic Rickettsia bellii are transmitted by D. variabilis in the United States (Burgdorfer 1975, Philip et al. 1983), but R. bellii has not yet been detected in Canada (Dergousoff et al. 2009).

Dergousoff et al. (2009) reported on the prevalence and distribution of Rickettsia spp. in Dermacentor spp. in the prairies of Canada. In their study, American dog ticks were collected from 15 localities within Alberta, Saskatchewan, Manitoba, and Ontario over a 4-year period. In areas where D. andersoni was present, the Rickettsia populations profiles looked different from what we observed because of the high prevalence of R. peacockii (range 36–96%). However, in 453 ticks screened from six localities across the three most eastern provinces sampled, where populations of D. variabilis are geographically separated from D. andersoni, there was an average infection prevalence of 9.17% (range, 0.00–33.00%) with 63 of the 453 ticks testing positive for R. montanensis. We focused on 11 collections and ten localities, with the majority collected in 2012, conducted in one province where only D. variabilis was collected. The average prevalence of infection per collection was 9.87% (range, 0.00–21.7%), with 103 of the 1044 ticks collected testing positive for R. montanensis. It is also notable that in both studies, the ticks from the localities closest to the northern distribution limit of D. variabilis were not infected with SFGR.

The distribution of R. montanensis appears to be patchy across the range of D. variabilis in the Canadian Prairie Provinces. It appears that populations of D. variabilis that are south of the historical distribution (Fig. 1) and, as a result, are well established tend to have higher prevalence of R. montanensis when compared to those closer to the northern range limit of the American dog tick when not in sympatry with D. andersoni. Populations that are closer or even north of the historical northern limit appear to have an absence of the bacterium or at least an undetected prevalence of infection with R. montanensis. It is possible that as D. variabilis expands its range in the province, and perhaps the country, the tick may be dispersing without R. montanensis.

Support for this is several fold. Under laboratory settings, D. variabilis appears to be able to transmit R. montanensis transovarially at a high degree of success for at least a few generations (Macaluso et al. 2002). However, the infection frequency detected in this and previous studies (Dergousoff et al. 2009) suggests that in nature horizontal transmission, through rodent reservoirs, may be the key mode of maintaining the bacterium in the tick population. Greatest range expansion of D. variabilis is achieved by movement of adult ticks infesting large mammals. Even if these ticks were infected at a high prevalence, adult dog ticks rarely feed upon rodents and, as a result, dispersing adult ticks would not initiate infection cycles in local rodent populations. Only the movement of infected larvae (which would promptly molt into infected nymphs) or infected rodents into areas where R. montanensis is absent would allow establishment of the infection. This disjunction in movement of the ticks preceding movement of pathogens has been well documented in Canada with regard to I. scapularis and Borrelia burgdorferi, the causative agent of Lyme disease (Ogden et al. 2013). B. burgdorferi is not transovarially transmitted either and typically requires rodent reservoirs. The requirement of a rodent reservoir may also explain the overall lower prevalence of infection by R. montanensis when compared to other rickettsiae, such as R. peacockii, that are transmitted transovarially (Kurtti et al. 2005). The exclusion of R. rickettsii by R. montanensis may hinder the emergence of Rocky Mountain spotted fever in Manitoba and has implications for the potential epidemiology of R. rickettsii if it ever emerges in Manitoba, because the province has abundant populations of vectors and hosts. Although these data primarily represent the distribution and prevalence of SFGR in adult D. variabilis in Manitoba during 2012, we did have specimens to test from Arbakka, Manitoba, collected in 2011. It is notable that the prevalence of infection for these 2 years did not differ significantly and occurred at a comparatively higher level than other localities. The sampling site in Arbakka was among the most southern sites in the study.

In addition to contributing to the knowledge of SFGR ecology in Manitoba, this study also has public health implications. R. montanensis is now known to be a human pathogen transmitted by the bite of infected D. variabilis (McQuiston et al. 2012). Although R. montanensis causes less morbidity than other pathogenic SFGR, there is the potential for increased morbidity in compromised individuals and the chance of under reporting. We provide critical, all be it preliminary, data that can be used to evaluate risk of this rickettsiosis in the province. Continued active surveillance conducted on an annual basis at a wider array of localities would strengthen our understanding of the annual variation in prevalence and distribution of R. montanensis in Manitoba. To gain a better understanding of the epidemiology of SFGR, additional research on the role of small mammal reservoirs from different geographic areas of the province would be informative. Although the burden of disease is unknown, physicians should also be aware that the bite from an American dog tick, the tick most commonly infesting humans in Manitoba, may, in some instances, have health implications caused by under-recognized, tick-associated pathogens such as R. montanensis.

Footnotes

Acknowledgments

We are grateful for the assistance provided by numerous people in this study. Diana Dunlop assisted in collection of ticks in Arbakka and Dunrea in 2012. Many individuals at the National Microbiology Laboratory in Winnipeg offered training and advice, including Antonia Dibernardo, Tyler Coté, Dr. Mahmood Iranpour, Dr. Heidi Wood, and Liz Dillon. Leanne Peixoto assisted with sequence alignment and identification. Manitoba Conservation issued work permit #2012-P-HQ-001 allowing for the collection of ticks from crown land and provincial parks. Also, many individuals granted access to their private property for the collection of ticks. Funding for this research was provided by Growing Forward, a program jointly funded by Manitoba Agriculture Food and Rural Initiatives and Agriculture and Agri-Food Canada.

Author Disclosure Statement

No competing financial interests exist.

References

Azad

, Beard

. Rickettsial pathogens and their arthropod vectors. Emerg Infect Dis, 1998; 4:179–186.

Burgdorfer

. Review of Rocky Mountian spotted fever (tick-borne typhus), its agent, and its tick vectors in the United States. J Med Entomol, 1975; 12:269–278.

Burgdorfer

, Anacker

. Rickettsiae and Rickettsial Diseases. New York: Academic Press, Inc., 1981.

Burgdorfer

, Friedhof

, Lancaster

. Natural history of tick-borne spotted fever in USA: Susceptibility of small mammals to virulent Rickettsia rickettsii . Bull World Health Organ, 1966; 35:149–153.

Dergousoff

, Gajadhar

, Chilton

. Prevalence of Rickettsia species in Canadian populations of Dermacentor andersoni and D. variabilis . Appl Environ Microbiol, 2009; 75:1786–1789.

Dergousoff

, Galloway

, Lindsay

, Curry

, et al. Range expansion of Dermacentor variabilis and Dermacentor andersoni (Acari: Ixodidae) near their northern distributional limits. J Med Entomol, 2013; 50:510–520.

Freitas

, Faccini

, Labruna

. 2009. Experimental infection of the rabbit tick, Haemaphysalis leporispalustris, with the bacterium Rickettsia rickettsii, and comparative biology of infected and uninfected tick lineages. Exp Appl Acarol, 2009; 47:321–345.

Gregson

. The Ixodoidea of Canada. Ontario: Canada Department of Agriculture, Publication 930, 1956.

Krakowetz

, Lindsay

, Chilton

. Genetic diversity in Ixodes scapularis (Acari: Ixodidae) from six established populations in Canada. Ticks Tick Borne Dis, 2011; 2:143–150.

10.

Kurtti

, Simser

, Baldridge

, Palmer

, et al. Factors influencing in vitro infectivity and growth of Rickettsia peacockii (Rickettsiales: Rickettsiaceae), an endosymbiont of the Rocky Mountain wood tick, Dermacentor andersoni (Acari, Ixodidae). J Invertebr Pathol, 2005; 90:177–186.

11.

Macaluso

, Sonenshine

, Ceraul

, Azad

. Rickettsial infection in Dermacentor variabilis (Acari: Ixodidae) inhibits transovarial transmission of a second Rickettsia . J Med Entomol, 2002; 39:809–813.

12.

McQuiston

, Zemtsova

, Perniciaro

, Hutson

, et al. A febrile spotted fever group rickettsia infection after a bite from a Dermacentor variabilis tick infected with Rickettsia montanensis . Vector-Borne Zoonotic Dis, 2012; 12:1059–1061.

13.

Niebylski

, Peacock

, Schwan

. Lethal effect of Rickettsia rickettsii on its tick vector (Dermacentor andersoni). Appl Environ Microb, 1999; 65:773–778.

14.

Ogden

, Mechai

, Margos

. Changing geographic ranges of ticks and tick-borne pathogens: Drivers, mechanisms and consequences for pathogen diversity. Front Cell Infect Microbiol, 2013; 3:46.

15.

Ogden

, Bigras-Poulin

, O'Callaghan

, Barker

, et al. Vector seasonality, host infection dynamics and fitness of pathogens transmitted by the tick Ixodes scapularis . Parasitology, 2007; 134:209–227.

16.

Ogden

, Bigras-Poulin

, Hanincova

, Maarouf

, et al. Projected effects of climate change on tick phenology and fitness of pathogens transmitted by the North American tick Ixodes scapularis . J Theor Biol, 2008a; 254:621–632.

17.

Ogden

, Lindsay

, Hanincova

, Barker

, et al. Role of migratory birds in introduction and range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. Appl Environ Microb, 2008b; 74:1780–1790.

18.

Philip

, Kohls

. Elk, winter ticks, and Rocky Mountian spotted fever: A query. Public Health Rep, 1951; 66:1672–1675.

19.

Philip

, Casper

, Anacker

, Cory

, Hayes

, et al. Rickettsia bellii sp. nov.: A tick-borne rickettsia, widely distributed in the United States, that is distinct from the spotted fever and typhus biogroups. Int J Syst Bacteriol, 1983; 33:94–106.

20.

Randolph

. Tick ecology: Processes and patterns behind the epidemiological risk posed by ixodid ticks as vectors. Parasitology, 2004; 129:S37–S65.

21.

Raoult

, Parola

. Rickettsial Diseases. New York: Informa Healthcare USA, Inc., 2007.

22.

Regnery

, Spruill

, Plikaytis

. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol, 1991; 173:1576–1589.

23.

Reich

. Microtus pennsylvanicus. Mammalian Species, 1981; 159:1–8.

24.

Roux

, Fournier

, Raoult

. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol, 1996; 34:2058–2065.

25.

Rózsa

, Reiczigel

, Majoros

. Quantifying parasites in samples of hosts. J Parasitol, 2000; 86:228–232.

26.

Sokal

, Rohlf

. Biometry. New York: W.H. Freeman and Company, 1995.

27.

Stenos

, Graves

, Unsworth

. A highly sensitive and specific real-time PCR assay for the detection of spotted fever and typhus group rickettsiae. Am J Trop Med Hyg, 2005; 73:1083–1085.

28.

Tabachnick

. Challenges in predicting climate and environmental effects on vector-borne disease episystems in a changing world. J Exp Biol, 2010; 213:946–954.

29.

Wilkinson

. The distribution of Dermacentor ticks in Canada in relation to bioclimatic zones. Can J Zoolog, 1967; 45:517–537.

30.

Wood

, Artsob

. Spotted fever group rickettsiae: A brief review and a Canadian perspective. Zoonoses Public Hlth, 2012; 59:65–79.

31.

Wölfel

, Essbauer

, Dobler

. Diagnostics of tick-borne rickettsioses in Germany: A modern concept for a neglected disease. Int J Med Microbiol, 2008; 298:368–374.