Occurrence of Borrelia burgdorferi Sensu Lato in Ixodes ricinus Ticks with First Identification of Borrelia miyamotoi in Vojvodina,Serbia

Abstract

Lyme borreliosis is the most common tick-borne infectious disease in Eurasia. Borrelia miyamotoi is the only known relapsing fever Borrelia group spirochete transmitted by Ixodes species. The aim of this study was to investigate the presence of Lyme Borrelia spp. and relapsing fever Borrelia spp. in Ixodes ricinus ticks collected from dogs and the vegetation from different parts of Vojvodina, Serbia. A total of 71 Ixodes ricinus ticks were collected and screened for the presence of Lyme Borrelia spp. group and relapsing fever Borrelia spp. by real-time PCR for the Borrelia flagellin B (flaB) gene followed by DNA sequencing of PCR products. Species identification was verified by PCR of the outer surface protein A (ospA) gene for Lyme Disease Borrelia spp. and by PCR of the glycerophosphodiester phosphodiesterase (glpQ) gene for relapsing fever Borrelia spp. Lyme Borrelia spp. were found in 15/71 (21.13%) of the ticks evaluated and included B. luisitaniae (11.3%), B. afzelii (7%), B. valaisiana (1.4%), and B. garinii (1.4%). Borrelia miyamotoi, from the relapsing fever Borrelia complex, was found, for the first time in Serbia, in one (1.4%) nymph collected from the environment. Co-infections between Borrelia species in ticks were not detected. These results suggest that the dominance of species within B. burgdorferi s.l. complex in I. ricinus ticks may vary over time and in different geographic regions. Further systematic studies of Borrelia species in vectors and reservoir hosts are needed to understand eco-epidemiology of these zoonotic infections and how to prevent human infection in the best way.

Introduction

Spirochetes of the genus Borrelia pathogenic to humans consist of two main groups, the first group that includes the causative agents of Lyme borreliosis, is widespread throughout the Northern Hemisphere and transmitted by tick members of the genus Ixodes, while the second group, causing relapsing fever, is transmitted by soft ticks, hard ticks, and lice (Szekeres et al. 2015).

Of all human vector-borne infections in Europe, Lyme borreliosis, a multi-system disorder caused by spirochetes from the B. burgdorferi sensu lato complex, is most commonly reported. It was estimated that about 85,000 new human cases of this disease occur annually in Europe, while in the United States there are between 16,000 and 20,000 cases per year (Lindgren and Jaenson 2006). The natural reservoir of Borrelia are wild mammals, lizards, and birds. Ixodes ticks represent the main vectors of B. burgdorferi s.l., in Europe mainly I. ricinus, in Asia Ixodes persulcatus, in the northeastern and upper midwestern United States Ixodes scapularis, and in the western United States Ixodes pacificus. Different competent tick vectors are able to acquire, maintain, and transmit Borrelia from one host to another, including humans (Ružić-Sabljić and Cerar 2016).

The development of molecular biology methods and the occurrence of new or so far unidentified species causing Lyme borreliosis have dramatically changed the understanding and recognition of the different clinical manifestations of the disease as reported in studies involving molecular characterization of local isolates (Rudenko et al. 2011).

Currently, on the basis of numerous genetic and phylogenetic analyses, at least 20 genospecies have been described in the B. burgdorferi s.l. complex. Five of these species, Borrelia afzelii, Borrelia garinii, Borrelia bavariensis, Borrelia burgdorferi sensu strict, and Borrelia spielmanii have been described as the causative agents of Lyme borreliosis in humans. Other Borrelia species (Borrelia lusitaniae, Borrelia bissettii, Borrelia valaisiana, and the recently described B. finlandensis) were rarely or never isolated from humans and their pathogenicity remains unclear (Skotarczak 2014, Ružić-Sabljić and Cerar 2016). In I. ricinus ticks, B. afzelii, B. garinii, and B. burgdorferi s.s. are the most common European circulating genospecies, all infecting humans and dogs (Skotarczak 2014).

In the geographic region of Vojvodina, Serbia, only these three species of B. burgdorferi s.l. complex (B. burgdorferi s.s., B. afzelii, and B. garinii) were previously registered in I. ricinus ticks (Savić et al. 2010, Tomanović et al. 2010, Potkonjak et al. 2014).

The second group includes several relapsing fever Borrelia species, such as B. hermsii, B. turicatae, and B. parkeri of the New World (Nearctic), in addition to B. duttonii and B. crocidurae of the Old World (Palearctic and Afrotropic ecozone) (Siński et al. 2016). Borrelia miyamotoi, which belongs to the relapsing fever group, is transmitted by the same Ixodes species that also transmit Lyme borreliosis spirochetes and is the only known agent causing relapsing fever transmitted by hard ticks. Over the last decade, it has also been detected in I. ricinus ticks throughout Europe (Szekeres et al. 2015). B. miyamotoi has been detected throughout Europe in low prevalence (Siński et al. 2016). To our knowledge there are no reports of the presence of B. miyamotoi in Serbia.

The aim of this study was to investigate the presence of Lyme Borrelia spp. and relapsing fever Borrelia spp. in I. ricinus ticks collected from dogs and the vegetation from different parts of Vojvodina, Serbia.

Materials and Methods

Tick collection and identification

Questing ticks were collected from the vegetation using the “flag-hour” method (Maupin et al. 1991). The study was performed in four localities in Vojvodina, Serbia: Andrevlje (N 45°10′268" E 19°38′496"), Zmajevac (N 45°09′321" E 19°46′508), Kać (N 45°17′667" E 19°54′019"), and Subić (N 45°16′296" E 19°54′571"). In addition, ticks were collected from infested dogs admitted to five veterinary clinics in Novi Sad (N 45°15′593" E 19°49′592", Vojvodina, Serbia). Tick species were identified according to the following morphological keys: Nosek and Sixl (1972), Estrada-Pena et al. (2004), and Walker et al. (2007). Ticks of the same life stages sampled on the same date and from the same locality/dog were pooled together in one vial and kept in 70% ethanol until further analyzed.

DNA extraction

After elimination of ethanol from each vial, ticks were washed again in 70% ethanol and then twice in phosphate-buffered saline (PBS). The ticks were cut symmetrically into two halves. One half of each tick was transferred to a plastic microtube and 0.5 mL of PBS was added, and the other half was stored frozen at −80°C for further analysis. Each sample was manually homogenized with plastic sterilized pestles for 1 min, and then centrifuged for 10 s at 2000 × g. Then, the supernatant was collected and DNA was extracted using a DNA extraction kit (Illustra Tissue Mini Spin kit; GE Healthcare, Little Chalfont, United Kingdom) according to the manufacturer's instructions.

PCR amplification

The detection of Borrelia species in all ticks was performed by screening Ixodes ricinus DNA samples by a real-time PCR assay targeting a 346-bp fragment of the Borrelia flagellin B (flaB) gene (Fukunaga et al. 2001). After sequencing, some flaB-positive samples showed the same percentage of identity to more than one Borrelia spp.; therefore, a second PCR to amplify a 280-bp fragment of the relapsing fever-specific glycerophosphodiester phosphodiesterase (glpQ) gene developed for this study, was used to further characterize these samples.

Real-time PCR targeting the flaB and glpQ genes was carried out with an initial hold for 4 min at 95°C, followed by 50 cycles of 15 s at 95°C, 30 s at 52°C (fluorescence acquisition on the Green channel) and 15 s at 72°C. The melting phase started at 60°C, each step rising by 1°C (fluorescence acquisition on the Green channel), and finished at 95°C with a hold for 90 s at the first step and 5 s at the subsequent steps. Each reaction was performed in 20 μL containing 4 μL of DNA, 0.25 μM of each primer, 0.6 μL of syto9 (Invitrogen, CA), 4.4 μL of double distilled water, and 10 μL of Maxima Hot Start PCR Master Mix (Thermo Scientific, Loughborough, United Kingdom).

When the flaB-targeted PCR gave the same identity scores and the glpQ PCR was negative, samples were retested by a nested PCR assay targeting 561 and a 352 bp segments of the outer surface protein A (ospA) gene. OspA PCR was performed in 25 μL volume containing 0.4 μM of the primers, 4 μL DNA, and 19 μL double distilled water, in a nucleotide-enzyme mix PCR-Ready™ (Syntezza, Jerusalem, Israel) and for the second PCR, 1 μL of PCR product was used as a DNA template. The PCR program used for ospA detection was carried out as previously described (Clark et al. 2005). The PCR primers used in this study are described in Table 1.

Table 1.

PCR Primers Used to Amplify Borrelia spp. from Ixodes ricinus in This Study

Target gene	Primer used	5′-3′ Primer sequence	Amplicon length (bp)	Reference
flaB	Bfpbu	GCTGAAGAGCTTGGAATGCAACC	346	Fukunaga et al. (2001)
	Bfpcr	TGATCAGTTATCATTCTAATAGCA
glpQ	Glpq-510f	AAAACCCTTTTGGCATAAACAACA	280	This study
	Glpq-770r	CCAGGGTCCAATTCCGTCAG
ospA	N1	GAGCTTAAAGGAACTTCTGATAA	561	Clark et al. (2005)
	C1	GTATTGTTGTACTGTAATTGT
ospA (nested PCR of N1-C1)	N2	ATGGATCTGGAGTACTTGAA	352	Clark et al. (2005)
	C2	CTTAAAGTAACAGTTCCTTCT

Positive Borrelia-DNA (B. persica, B. miyamotoi and B. burgdorferi), negative Borrelia-DNA, and a nontemplate DNA controls were used in each run. Control B. miyamotoi DNA was kindly provided by Dr. Hein Sprong from the National Institute of Public Health and Environment (RIVM) in Bilthoven, The Netherlands.

DNA sequencing

All positive PCR products were purified using a PCR purification kit (Exo-SAP; New England BioLabs, Inc., Ipswich, MA) and subsequently sequenced by Applied Biosystems ABI 3700DNA analyzer and evaluated by the ABI's data collection and sequence analysis software (ABI, Carlsbad, CA). DNA-sequences were aligned using Mega (version 6; The Biodesign Institute) after retiring the areas belonging to the primers; subsequently, they were compared with the GenBank database using the BLAST algorithm (http://blast.ncbi.nlm.nih.gov/Blast.cgi) Samples were considered positive to a specific Borrelia spp. if sequencing indicated that the closest GenBank accession match was 99–100% identical to the identified organism.

Results

A total of 71 I. ricinus (Linnaeus 1758) ticks were collected, namely 45 engorged adult ticks from dogs and 26 questing ticks from the vegetation (12 nymphs and 14 adult stages).

All samples were screened by targeting the flaB gene and 16 samples were positive by this PCR. Of these 16, thirteen samples could be identified after sequencing this gene segment alone (eight ticks harbored Borrelia luisitaniae and five Borrelia afzelii). Two samples with suspected presence of Lyme Borrelia spp. were examined by PCR of the ospA gene; after sequencing, these Borrelia-infected samples were confirmed to harbor Borrelia valaisiana and Borrelia garinii, respectively. Finally, one sample with suspected presence of relapsing fever B. myiamotoi was further analyzed by PCR targeting the glpQ gene and B. myiamotoi DNA was successfully identified after sequencing both the flaB and glpQ genes.

The efficacy of the PCR was confirmed with the amplification of positive Borrelia-DNA (B. persica, B. miyamotoi and B. burgdorferi) available in our laboratory. The new sequences obtained in this study were deposited in GenBank under the following accession numbers: Borrelia luisitaniae (KU559866 and KU559867), Borrelia afzelii (KU559868 and KU559869), Borrelia valaisiana (KU559871), Borrelia garinii (KU559872), and Borrelia miyamotoi (flaB: KU559870; glpQ: KU559873).

The total rate of infection with Lyme Borrelia spp. in the ticks was 21.13%, with 16.9% of the adult ticks and 41.6% of the nymphs infected; 35.6% of the infected ticks were from the environment and 13.3% were collected from dogs. Borrelia luisitaniae was found in eight (11.3%) of the ticks, B. afzelii was detected in five (7%), B. valaisiana and B. garinii each in one tick (1.4%), respectively.

Borrelia luisitaniae was found in five adult ticks collected from dogs (from the locality of Novi Sad), and from an adult tick and two nymphs collected from the environment (from Andrevlje). Borrelia afzelii was found in an adult tick collected from dog from Novi Sad, three adult ticks (one from Andrevlje and two from Zmajevac), and one nymph (from Andrevlje) collected from the environment. Borrelia valaisiana was found in a nymph collected from the environment (from Andrevlje), B. garinii was detected in a nymph collected from the environment (from Zmajevac).

Borrelia miyamotoi, from the relapsing fever Borrelia complex, was found in one (1.4%) nymph collected from the environment (from Andrevlje).

Co-infections between Borrelia species in ticks were not detected. The closest GenBank accession number to each amplified sequence, percentage of identity, GenBank accession number after submission, amplicon length, amplified gene, origin and number of positive ticks are described in Table 2.

Table 2.

Sequence Similarities of flaB, ospA, and glpQ DNA Sequences Detected in Ticks to GenBank-Deposited Sequences, Amplicon Length, and No. of I. ricinus ticks in Which the Borrelia Species Was Identified

Borrelia species	Targeted gene	Closest GenBank accession no. (% sequence identity)	GenBank accession no. after submission	Amplicon length (bp)	No. of ticks in which the species was identified, followed by: the no. of ticks from the environment; no. of ticks from dogs; no. of infected adult and no. of nymphal ticks
Borrelia luisitaniae	flaB	KF894062.1 (99–100)	KU559866	300–301	8; 3; 5; 6; 2
			KU559867
Borrelia afzelii	flaB	KM198345.1 (99–100)	KU559868	300	5; 4; 1; 4; 1
			KU559869
Borrelia valaisiana	ospA	CP001433.1 (100)	KU559871	514	1; 1; 0; 0; 1
Borrelia garinii	ospA	KM069306.1 (99)	KU559872	314	1; 1; 0; 0; 1
Borrelia miyamotoi	glpQ	KJ003844.1 (100)	KU559873	236	1; 1; 0; 0; 1
	flaB	KJ847050.1 (100)	KU559870	294

Discussion

Serbia is considered endemic for Lyme borreliosis with a large number of human patients in some areas of the country (Jovanovic et al. 2015). Previously, Savić et al. (2010) identified three strains of Lyme borrelia from I. ricinus ticks from the area of Vojvodina as B. afzelii, while 1 strain was identified as B. burgdorferi s.s. by PCR, using genospecies-specific primers for B. burgdorferi genotyping. In the same geographic area, Potkonjak et al. (2014) have also found that B. afzelii is the dominant Lyme borrelia by MluI-LRFP and real-time PCR for hbb gene. MluI-LRFP indicated that all three isolated strains of B. afzelii were characterized as subtype Mlal.

Other researchers from the Belgrade area in Serbia reported different Lyme borrelia species prevalence. Similar to our findings, Tomanović et al. (2010) found that B. lusitaniae was the dominant species (18.8%) with B. burgdorferi s.s. in 13.6%, B. afzelii in 7.7%, B. garinii in 4.9%, and B. valaisiana in 3.8% of the I. ricinus ticks. However, Ristanovic et al. (2007) reported the presence of only B. burgdorferi s.s. in I. ricinus ticks, while, Cakanec et al. (2010) found dominance of B. afzelii (75%), with a lower presence of B. burgdorferi s.s. (22.2%) and B. garinii (2.8%) in I. ricinus.

According to the on record studies on Lyme borrelia distribution in Europe their prevalence may vary widely in different regions of Europe, yet B. afzelii and B. garinii are the most common genospecies found, but with B. lusitaniae as the main indicator species for meridional territories (Rauter and Hartung 2005, Estrada-Peña et al. 2011, Kalmár et al. 2013). In this study, we found that B. lusitaniae was the dominant (11.3%) Lyme borrelia species in I. ricinus in the geographic area of Vojvodina, Serbia. Our outcomes and other researchers’ results suggest that dominance of Lyme borrelia species in I. ricinus in Serbia depends on the geographic area and year of research. Rudenko et al. (2011) suggested that descriptions of different species of Borrelia in ticks contribute to understanding the ecology of Lyme borreliosis.

Different Lyme Borrelia spp. were reported to cause distinct clinical manifestations, whereas some species were associated with defined clinical manifestation like B. afzelii with skin manifestations, B. garinii with central nervous system disorders, and B. burgdorferi s.s. with Lyme arthritis. Thus, genotyping of borrelia strains is of great importance for epidemiological, clinical, and evolutionary studies (Ružić-Sabljić and Cerar 2016). Furthermore, identification of the different species of Borrelia in ticks is important for understanding the expected clinical manifestations of Lyme borreliosis in different regions, because it may depend on which species is causing the infection (Shapiro and Gerber 2000).

Although previous studies have detected most of the Lyme Borrelia spp. found in this study, this is the first report of the relapsing fever complex, B. miyamotoi in Serbia, which was identified in a nymphal questing I. ricinus tick. Borrelia miyamotoi infection causes relapsing fever and Lyme borreliosis—like symptoms in countries throughout the Holarctic region of the world (Platonov et al. 2011). The documentation of B. miyamotoi expands the spectrum of Borrelia species detected in I. ricinus ticks and justifies the inclusion of this species as a potential human pathogen in Serbia.

The range of B. miyamotoi infection rates in I. ricinus nymphal ticks varied from 0% to 3.2% in studies from different European countries including the Czech Republic, Denmark, England, Estonia, France, Germany, The Netherlands, Poland, Sweden, and Switzerland (Krause et al. 2015). As in our finding, Szekeres et al. (2015) detected the presence of B. miyamotoi in one questing I. ricinus nymph in Hungary, which borders with Serbia. Recent studies also indicate its presence in the United Kingdom, Belgium, Norway, and Portugal (Cochez et al. 2015, Hansford et al. 2015, Kjelland et al. 2015, Nunes et al. 2015). Therefore, B. miyamotoi infection should be considered in patients with acute febrile illness who have been exposed to Ixodes ticks in a region where Lyme borreliosis endemic occurs (Krause et al. 2015).

The molecular screening method targeting the flaB proved to be efficient due to its sensitivity and since the flaB is present in both the Lyme Borrelia spp. group and the relapsing fever Borrelia spp. However, in three cases it was necessary to confirm the species identity with an additional PCR. We recommend a real-time PCR approach for screening and a second PCR in case the first does not yield a specific result sufficient for species determination after GenBank alignment. We propose PCR of the ospA for detection of the Lyme Disease Borrelia spp. and glpQ PCR for relapsing fever Borrelia spp. A multiple PCR protocol for detection of some Borerlia spp. is necessary, for example, in case of very similar sequences between closely related Borrelia spp.

Biologically, different processes involve the physiological and behavioral response of ticks to temperature, moisture stress, and day length that result in specific patterns of seasonal population dynamics and host relationships (Randolph 2004). The small number of questing ticks collected for this study was probably a result of impacts of different factors like temperature, day length (diapause), saturation, host species, and its density, which affected the spatial and temporal variation of ticks.

Conclusions

This study identified B. miyamotoi in Serbia and confirmed the presence of four species of B. burgdorferi s.l. in I. ricinus ticks in this country. These results suggest that the dominance of species within B. burgdorferi s.l. complex may change from year to year, and in different geographic regions. Further systematic studies of Borrelia species in vectors and reservoir hosts are needed to understand eco-epidemiology of these zoonotic infections and how to prevent human infection in the best way.

Footnotes

Acknowledgments

This study was supported by a short-term scientific mission (STSM) at the Koret School of Veterinary Medicine, Hebrew University, Israel, provided by TD1303 COST Action entitled “European Network for Neglected Vectors and Vector-Borne Infections (EurNegVec),” and by grants provided by Provincial Secretariat for Science and Technological Development, Autonomous Province of Vojvodina, Republic of Serbia (grant nos. 114-451-3060/2015-01). We thank Dr. Hein Sprong from the National Institute of Public Health and Environment (RIVM) in Bilthoven, the Netherlands, for providing control DNA of B. miyamotoi.

Author Disclosure Statement

No competing financial interests exist.

References

Cekanac

, Pavlovic

, Gledovic

, Grgurevic

, et al. Prevalence of Borrelia burgdorferi in Ixodes ricinus ticks in Belgrade area. Vector Borne Zoonotic Dis, 2010; 10:447–452.

Clark

, Hendricks

, Burge

. Molecular identification and analysis of Borrelia burgdorferi sensu lato in lizards in the southeastern United States. Appl Environ Microbiol, 2005; 71:2616–2625.

Cochez

, Heyman

, Heylen

, Fonville

, et al. The presence of Borrelia miyamotoi, a relapsing fever spirochaete, in questing Ixodes ricinus in Belgium and in the Netherlands. Zoonoses Public Health, 2015; 62:331–333.

Estrada-Pena

, Bouattour

, Camicas

, Walker

. Ticks of Domestic Animals in the Mediterranean Region: A Guide to Identification of Species. Spain: University of Zaragoza, 2004.

Estrada-Peña

, Ortega

, Sánchez

, DeSimone

, et al. Borrelia burgdorferi sl prevalence in questing Ixodes ricinus ticks correlates with specific abiotic traits in the Western Palearctic. Appl Environ Microbiol, 2011; 1–30.

Fukunaga

, Ushijima

, Aoki

, Talbert

. Detection of Borrelia duttonii, a tick-borne relapsing fever agent in central Tanzania, within ticks by flagellin gene-based nested polymerase chain reaction. Vector Borne Zoonotic Dis, 2001; 1:331–338.

Hansford

, Fonville

, Jahfari

, Sprong

, et al. Borrelia miyamotoi in host-seeking Ixodes ricinus ticks in England. Epidemiol Infect, 2015; 143:1079–1087.

Jovanovic

, Atanasievska

, Protic-Djokic

, Rakic

, et al. Seroprevalence of Borrelia burgdorferi in occupationally exposed persons in the Belgrade area, Serbia. Braz J Microbiol, 2015; 46:807–814.

Kalmár

, Mihalca

, Dumitrache

, Gherman

, et al. Geographical distribution and prevalence of Borrelia burgdorferi genospecies in questing Ixodes ricinus from Romania: A countrywide study. Ticks Tick Borne Dis, 2013; 4:403–408.

10.

Kjelland

, Rollum

, Korslund

, Slettan

, et al. Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick Borne Dis, 2015; 6:516–521.

11.

Krause

, Fish

, Narasimhan

, Barbour

. Borrelia miyamotoi infection in nature and in humans. Clin Microbiol Infect, 2015; 21:631–639.

12.

Lindgren

, Jaenson

. Lyme Borreliosis in Europe: Influences of Climate and Climate Change, Epidemiology, Ecology and Adaptation Measures. WHO Regional Office for Europe, Copenhagen, Denmark, 2006.

13.

Maupin

, Fish

, Zultowsky

, Campos

, et al. Landscape ecology of Lyme disease in a residential area of Westchester County, New York. Am J Epidemiol, 1991; 133:1105–1113.

14.

Nosek

, Sixl

. Central European ticks (Ixodoidea). Key for determination. Mitt Abt Zool Landesmus Joanneum, 1972; 1:61–92.

15.

Nunes

, Parreira

, Lopes

, Maia

, et al. Molecular identification of Borrelia miyamotoi in Ixodes ricinus from Portugal. Vector Borne Zoonotic Dis, 2015; 15:515–517.

16.

Platonov

, Karan

, Kolyasnikova

, Makhneva

, et al. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg Infect Dis, 2011; 17:1816–1823.

17.

Potkonjak

, Savić

, Ruzić-Sabljić

, Vračar

, et al. Molecular characterization of Borrelia strains isolated from ticks in Vojvodina. Parasit Vectors, 2014; 7:1.

18.

Randolph

. Tick ecology: Processes and patterns behind the epidemiological risk posed by ixodid ticks as vectors. Parasitology, 2004; 129:37–65.

19.

Rauter

, Hartung

. Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: A metaanalysis. Appl Environ Microbiol, 2005; 71:7203–7216.

20.

Ristanovic

, Kitamura

, Masuzawa

, Milutinovic

, et al. Molecular characterization of Borrelia burgdorferi sensu lato strains isolated in the area of Belgrade, Serbia. Braz J Microbiol, 2007; 38:14–16.

21.

Rudenko

, Golovchenko

, Grubhoffer

, Oliver

. Updates on Borrelia burgdorferi sensu lato complex with respect to public health. Ticks Tick Borne Dis, 2011; 2:123–128.

22.

Ružić-Sabljić

, Cerar

. Borrelia genotyping in Lyme disease. Open Dermatol J, 2016; 10:6–14.

23.

Savić

, Vidić

, Lazić

, Lako

, et al. Borrelia burgdorferi in ticks and dogs in the province of Vojvodina, Serbia. Parasite, 2010; 17:357–361.

24.

Shapiro

, Gerber

. Lyme disease. Clin Infect Dis, 2000; 31:533–542.

25.

Siński

, Welc-Falęciak

, Zajkowska

. Borrelia miyamotoi: A human tick-borne relapsing fever spirochete in Europe and its potential impact on public health. Adv Med Sci, 2016; 61:255–260.

26.

Skotarczak

. Why are there several species of Borrelia burgdorferi sensu lato detected in dogs and humans?. Infect Genet Evol, 2014; 23:182–188.

27.

Szekeres

, Coipan

, Rigo

, Majoros

, et al. Eco-epidemiology of Borrelia miyamotoi and Lyme borreliosis spirochetes in a popular hunting and recreational forest area in Hungary. Parasit Vectors, 2015; 8:309.

28.

Tomanović

, Radulović

, Masuzawa

, Milutinović

. Coexistence of emerging bacterial pathogens in Ixodes ricinus ticks in Serbia. Parasite, 2010; 17:211–217.

29.

Walker

, Bouattour

, Camicas

, A.

, et al. Ticks of Domestic Animals in Africa: A Guide to Identification of Species. Bioscience Reports, United Kingdom, 2007.