Vector-Borne Pathogens in Stray Dogs in Northeastern Turkey

Abstract

This experiment was carried out to attain prevalence and molecular characterization of pathogens causing canine vector-borne diseases (CVBDs) including babesiosis, hepatozoonosis, leishmaniasis, filariosis (Dirofilaria immitis, Dirofilaria repens, and Acanthocheilonema reconditum), ehrlichiosis (Ehrlichia canis), and anaplasmosis (Anaplasma platys) in stray dogs. The study material consisted of 133 asymptomatic female (n = 96) and male (n = 37) stray dogs (≤1 year old, n = 16 and 1–6 years old, n = 117) housed in the Animal Care and Rehabilitation Center, Erzurum, Northeastern Turkey. Conventional and nested PCR were performed on blood samples to detect Babesia spp., Leishmania spp., Hepatozoon spp., D. immitis, D. repens, A. reconditum, E. canis, and A. platys. Sex and age association with the pathogen prevalence was determined using X² statistics. The positivity rate for at least one CVBD pathogen was 48.9% (65/133). DNA of B. canis, Hepatozoon spp., H. canis, D. immitis, and E. canis were detected in 5.3% (7/133), 27.1% (36/133), 5.3% (7/133), 1.5% (2/133), and 9.8% (13/133) of the dogs, respectively. Leishmania spp., D. repens, A. reconditum, and A. platys DNA were not detected. Mixed pathogens were determined in seven (10.8%) of the infected dogs, with predominant involvement of Hepatozoon spp. or H. canis. The pathogen prevalence did not vary by sex or age. Nucleotide blast analysis of Erzurum isolates showed 99.8–100% identities with the corresponding reference isolates. This study indicates presence of five CVB pathogens, including the first report of E. canis, in stray dogs in Erzurum, Turkey.

Introduction

Canine vector-borne diseases (CVBDs) are caused by a wide range of pathogens transmitted by arthropods. Due to global distribution and rapid spread, CVBDs are of great concern to the world. In addition to causing morbidity and mortality in dogs, some of them have zoonotic importance (Otranto et al. 2009, Maia et al. 2015). These diseases are usually accompanied by nonspecific signs and clinical symptoms depending on the pathogen and host (Baneth et al. 2012).

Presence and prevalence of vector-borne diseases depend on various factors. These may span from the current vector population, introduction of new vector species, and host/reservoir population to animal transportation from endemic regions and application of vector control programs. As climatological changes become an important issue, reports on existing and new CVBDs are being updated very frequently across the world.

Previous studies involving domestic dogs in Erzurum reported the presence of Babesia canis, Hepatozoon canis, and Dirofilaria immitis by PCR analysis (b, Simsek et al. 2011, Aktas et al. 2015a). Stray dogs are likely to act as a reservoir to several pathogens and a source for naive vectors. Moreover, presence of CVBDs is closely associated with the vector species inhabiting the area. In the control program the first step should be aimed to elucidate the prevalence of pathogens causing CVBDs and identify their vectors. This study is aimed to attain the prevalence of pathogens causing babesiosis, hepatozoonosis, leishmaniasis, filariosis (D. immitis, Dirofilaria repens, Acanthocheilonema reconditum), ehrlichiosis (Ehrlichia canis), and anaplasmosis (Anaplasma platys) and reveal their molecular characterization using the PCR method in stray dogs in Erzurum, Northeastern Turkey.

Material and Methods

Study area and sample collection

Erzurum is a province of Turkey in the Northeastern Anatolia (39°52′N, 41°17′E) and has the fourth largest surface area (25,066 km²) in the country. The majority of the province is highland and situated at 1853 m above sea level. Continental climate conditions (long and harsh winter—short and mild summer) rule in the province, with the average low temperature of −8.6°C (16.5°F) and the average high temperature of 12°C (54°F). The average annual precipitation is 453 mm (17.8 in). Snow falls on an average of 80 days and remains for about 150 days.

The officers of Animal Care and Rehabilitation Center under division of Erzurum Metropolitan Municipality regularly collect stray dogs and cats. After drug application for ectoparasites they are kept under observation for at least 2 weeks. In addition to vaccination against rabies and praziquantel application for tapeworms, rehabilitation and medical service are provided. After sterilization, the animals are ear-tagged and then be either set free or adopted. However, they are not specifically examined for vector-borne pathogens.

The study was approved by the Animal Research Local Ethics Committee of Ataturk University Veterinary Faculty (Protocol no: 2012/54). During 2012–2013, 191 animals were brought to the Animal Care and Rehabilitation Center. A total of 133 asymptomatic stray dogs (age: 16 juvenile [≤1 year] and 117 adult [1–6 years], gender: 96 female and 37 male) were investigated between July 2012 and August 2013 in routine visit. On the sampling day, stray dogs were not subjected to a comprehensive physical examination, but tick exposure. Blood samples (2–3 mL) were collected from vena cephalica antebrachii into ethylenediaminetetraacetic acid (EDTA)-coated vacutainer tubes. Information including age, sex, date, and ear-tag number of the dog was recorded. Blood samples were kept in −80°C until DNA extraction,

DNA extraction and PCR analysis

DNA extraction was performed by using a commercial DNA extraction kit (G-spin™ Total DNA Extraction Kit; Intron Biotechnology Inc., Kyungki-do, Korea) according to the manufacturer's instructions. The concentrations of extractions were checked with the Qubit™ 3.0 Fluorometer (Thermo Fisher Scientific Inc., Waltham, MA). Extracted DNA was stored in a freezer at −20°C until further steps.

Conventional and nested PCR were performed to detect Babesia spp., Leishmania spp., Hepatozoon spp., D. immitis, D. repens, A. reconditum, E. canis, and A. platys. Primers and PCR conditions are summarized in Table 1. All amplifications were performed in a Veriti gradient thermal cycler (Applied Biosystems, Carlsbad, CA). Positive and negative controls were included in each PCR run. The PCR products were analyzed using 1.5% agarose gel electrophoresis, stained with ethidium bromide, and photographed using UV transillumination (Eberhardzell, Germany, Vilber Lourmat, Quantum ST4, 1100).

Table 1.

Summary of PCR Methods Used in This Study

Target	Primers 5′-3′	Cycle conditions	References
Babesia spp. 18S rRNA gene	Babesia F: GTGAAACTGCGAATGGCTCA	95°C 5 min; 34 cycles: 95°C 30 s–55°C 30 s–72°C 90 s; 72°C 5 min	Inokuma et al. (2003)
Babesia spp. 18S rRNA gene	Babesia R: CCATGCTGAAGTATTCAAGAC		Inokuma et al. (2003)
Babesia canis 18S rRNA gene	Can 172F: GTTTATTAGTTTGAAACCCGC	95°C 5 min; 34 cycles: 95°C 30 s–55°C 30 s–72°C 90 s; 72°C 5 min	Inokuma et al. (2004)
Babesia canis 18S rRNA gene	Can 626R: GAACTCGAAAAAGCCAAACGA		Inokuma et al. (2004)
Babesia gibsoni 18S rRNA gene	Gib599F: CTCGGCTACTTGCCTTGTC	95°C 5 min; 34 cycles: 95°C 30 s–55°C 30 s–72°C 90 s; 72°C 5 min	Inokuma et al. (2004)
Babesia gibsoni 18S rRNA gene	Gib1270R: GCCGAAACTGAAATAACGGC		Inokuma et al. (2004)
Hepatozoon spp. 18S rRNA gene	Hep F: ATACATGAGCAAAATCTCAAC	95°C 5 min; 34 cycles: 95°C 30 s–57°C 30 s–72°C 90 s; 72°C 5 min	Inokuma et al. (2002)
Hepatozoon spp. 18S rRNA gene	Hep R: CTTATTATTCCATGCTGCAG		Inokuma et al. (2002)
Leishmania spp. small subunit ribosomal RNA (ssr RNA) gene	R221: GGTTCCTTTCCTGATTTACG	95°C 5 min; 35 cycles: 94°C 30 s–60°C 30 s–72°C 30 s; 72°C 10 min	Van Eys et al. (1992)
	R332: GGCCGGTAAAGGCCGAATAG		Van Eys et al. (1992)
Pan-filarial 5.8 S-ITS2-28S gene	DIDR-F1: AGTGCGAATTGCAGACGCATTGAG	94°C 2 min; 32 cycles: 94°C 30 s–60°C 30 s–72°C 30 s; 72°C 7 min	Rishniw et al. (2006)
Pan-filarial 5.8 S-ITS2-28S gene	DIDR-R1: AGCGGGTAATCACGACTGAGTTGA		Rishniw et al. (2006)
Dirofilaria immitis cytochrome oxidase subunit 1 (COI) gene	DICOI-F1: AGTGTAGAGGGTCAGCCTGAGTTA	94°C 2 min; 32 cycles: 94°C 30 s–58°C 30 s–72°C 30 s; 72°C 7 min	Rishniw et al. (2006)
	DICOI-R1: ACAGGCACTGACAATACCAAT		Rishniw et al. (2006)
Acanthocheilonema reconditum cytochrome oxidase subunit 1 (COI) gene	ARCOI-F1: AGTGTTGAGGGACAGCCAGAATTG	94°C 2 min; 32 cycles: 94°C 30 s–58°C 30 s–72°C 30 s; 72°C 7 min	Rishniw et al. (2006)
	ARCOI-R1: CCAAAACTGGAACAGACAAAACAAGC		Rishniw et al. (2006)
Dirofilaria repens cytochrome oxidase subunit 1 (COI) gene	DRCOI-F1: AGTGTTGATGGTCAACCTGAATTA	94°C 2 min; 32 cycles: 94°C 30 s–58°C 30 s–72°C 30 s; 72°C 7 min	Rishniw et al. (2006)
	DRCOI-R1: GCCAAAACAGGAACAGATAAAACT		Rishniw et al. (2006)
Ehrlichia spp. 16S rRNA gene	ECC: AGAACGAACGCTGGCGGCAAGC	94°C 3 min; 35 cycles: 94°C 1 min–68°C 2 min–72°C 2 min	Carvalho et al. (2008)
Ehrlichia spp. 16S rRNA gene	ECB: CGTATTACCGCGGCTGCTGGCA	94°C 3 min; 35 cycles: 94°C 1 min–68°C 2 min–72°C 2 min	Carvalho et al. (2008)
Ehrlichia canis 16S rRNA gene	Ecan5: CAATTATTTATAGCCTCTGGCTATAGGA	94°C 3 min; 35 cycles: 94°C 1 min–58°C 2 min–72°C 1.5 min	Carvalho et al. (2008), Murphy et al. (1998)
Ehrlichia canis 16S rRNA gene	HE3: TATAGGTACCGTCATTATCTTCCCTAT	94°C 3 min; 35 cycles: 94°C 1 min–58°C 2 min–72°C 1.5 min	Carvalho et al. (2008), Murphy et al. (1998)
Ehrlichia genus 16S rRNA gene	fD1: AGAGTTTGATCCTGGCTCAG	95°C 5 min; 34 cycles: 95°C 30 s–53°C 30 s–72°C 90 s; 72°C 5 min	Inokuma et al. (2001)
Ehrlichia genus 16S rRNA gene	EHR16SR: TAGCACTCATCGTTTACAGC		Inokuma et al. (2001)
Anaplasma platys 16S rRNA gene	Platys F: AAGTCGAACGGATTTTTGTC	95°C 5 min; 34 cycles: 95°C 30 s–55°C 30 s–72°C 90 s; 72°C 5 min	Inokuma et al. (2001)
Anaplasma platys 16S rRNA gene	Platys R: CTTTAACTTACCGAACC		Inokuma et al. (2001)

Sequence analysis

Some of the positive PCR products with high DNA concentrations were purified using the PureLink quick gel extraction kit (Invitrogen, Carlsbad, CA). Bidirectional sequencing was performed with an ABI PRISM 310 genetic analyzer (Applied Biosystems) using the PCR primers. All sequence data were edited and aligned using Bioedit 7.2.5 (www.mbio.ncsu.edu/BioEdit/bioedit.html) and Finch TV Version 1.4.0 (www.geospiza.com/finchtv) following naked eye checking. The sequences were compared with known sequences in GenBank database by the nucleotide sequence homology search facilitated by the National Centre for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST) (www.ncbi.nlm.nih.gov/BLAST) analysis database to confirm each parasite. Obtained partial nucleotide sequences with excellent quality were deposited in GenBank under the following accession numbers: KY247105 to KY247107 for B. canis, KY247108 to KY247110 for E. canis, KY247111 to KY247117 for H. canis, and KY247118, KY247119 for D. immitis.

Statistical analysis

Pathogens were identified and enumerated. The count data were subjected to a 2 × 2 contingency-tabulation for X ² statistics using the PROC. FREQ procedure (Version 13.2.2; MedCalc, Ostend, Belgium) to attain associations of sex and age at p < 0.05.

Results

Sixty-five dogs (48.9%) were positive for at least one CVBD pathogen. The prevalence of positivity for DNA of B. canis, Hepatozoon spp., H. canis, D. immitis, and E. canis was 5.3% (7/133), 27.1% (36/133), 5.3% (7/133), 1.5% (2/133), and 9.8% (13/133), respectively. There was no positivity for DNA of Leishmania spp., D. repens, A. reconditum, and A. platys. Simultaneous infections by two CVBD pathogens were determined in 7 (10.8%) of the infected dogs (Table 2). There was association of neither sex nor age with the pathogen prevalence (Table 3).

Table 2.

Occurrences of Single and Mixed Infections as Detected by PCR Analysis

	n (%)
Single species infection
B. canis	7 (5.3)
Hepatozoon spp.	36 (27.1)
Hepatozoon canis	7 (5.3)
D. immitis	2 (1.5)
E. canis	13 (9.8)
Total	65 (48.9)
Mixed infection
B. canis + Hepatozoon spp.	1 (1.5)
B. canis + H. canis	2 (3.1)
Hepatozoon spp + E. canis	2 (3.1)
H. canis + E. canis	1 (1.5)
H canis + D. immitis	1 (1.5)
Total	7 (10.8)

n: Number of CVBD pathogen positive dogs.

Table 3.

Prevalence of Canine Vector-Borne Diseases Pathogens and Association of Sex and Age

	Prevalence n (%)		Factor
	Negative	Positive	Sex	Age
B. canis	126 (94.74)	7 (5.26)	X² = 0.83, P = 0.91	X² = 0.04, P = 0.60
Hepatozoon spp.	90 (67.67)	43 (32.33)	X² = 0.71, P = 0.85	X² = 1.53, P = 0.94
E. canis	120 (90.23)	13 (9.77)	X² = 0.81, P = 0.89	X² = 0.26, P = 0.83
D. immitis	131 (98.50)	2 (1.50)	X² = 0.78, P = 0.52	X² = 0.28, P = 1.00

Three out of the 7 B. canis, 7 out of the 43 Hepatozoon spp., 2 D. immitis, and 3 out of the 13 E. canis in Erzurum isolates with high DNA concentrations were chosen for sequencing. Nucleotide blast analysis of Erzurum isolates was compared with some previously published sequences achieved from GenBank (Table 4). Comparative sequence analysis showed that the percent identities among Erzurum isolates were 99.8–100% for B. canis, 99.6–100% for H. canis, and 100% for D. immitis and E. canis.

Table 4.

Erzurum Isolates and Their Level of Nucleotide Similarity with Reference Isolates

Erzurum isolate/GenBank Accession No.	Nucleotide identity (%)	Reference sequence (GenBank Accession No)
B. canis Erz1/KY247105	100.0	Italy (KX839232-horse)
B. canis Erz3/KY247107		Estonia (KT008057)
		Turkey-Kars (KF499115)
		Romania (HQ662634)
		Slovakia (DQ869307)
B. canis Erz2/KY247106	99.0	Italy (KX839232-horse)
		Estonia (KT008057)
		Turkey-Kars (KF499115)
		Romania (HQ662634)
		Slovakia (DQ869307)
H. canis Erz1/KY247111	100.00	Romania-fox (KM096414)
H. canis Erz 2/KY247112		Hungary (KJ572976)
H. canis Erz 3/KY247113		Italy (GU371448)
H. canis Erz 4/KY247114		Croatia (HM212626-fox, FJ497022)
H. canis Erz 5/KY247115		Turkey-Konya (KX641900)
H. canis Erz 7/KY247117		Turkey-Konya (KX641900)
H. canis Erz 6/KY247116	99.8	Japan (LC169075)
		Brazil (AY461375)
		Malaysia (KT267961)
		Turkey-Konya (KX641900)
D. immitis Erz1/KY247118	100.0	Iran (KT351852, KT960976)
D. immitis Erz2/KY247119		Spain (LC107816)
		Hungary (KM452921)
		Germany (KF692101)
		Japan (AB973226)
		Turkey-Kayseri (KF273904)
		France (KP760184)
E. canis Erz1/KY247108	100.0	Malaysia (KR920044)
E. canis Erz2/KY247109		China (KJ659037)
E. canis Erz3/KY247110		Turkey-Kayseri (KJ513197) Turkey-Kütahya (AY621071)
		South Africa (KC479023)
		Italy (EU439944, KX180945)
		Japan (AB723712)

Discussion

This study dealt with molecular analysis of some vector-borne pathogens of dogs including Babesia spp., Hepatozoon spp., and Leishmania spp., filarial agents, E. canis and A. platys in Erzurum province of Turkey. The geographical distribution of CVBDs is related to the presence and prevalence of competent vectors. In this study, CVBD pathogens were not matched with their vectors because the stray dogs had been medicated for ectoparasites before blood sampling.

Canine babesiosis is a tick-borne infection with global importance. Dogs have several species of Babesia including large Babesia species (B. canis, B. rossi, and B. vogeli) and small Babesia species (B. gibsoni, B. conradae, and Babesia microti-like sp.) (Uilenberg 2006, Solano-Gallego et al. 2016). Canine babesiosis caused by B. canis is prevalent in Europe (2.3–96%) and also reported in Asia (Matijatko et al. 2012, Solano-Gallego et al. 2016). Dermacentor reticulatus, vector of B. canis, is a tick of somewhat cooler areas and it is prevalent in Europe and Northern countries in Asia (Karbowiak, 2014, Rubel et al. 2016). Reports on the presence of B. vogeli (Gülanber et al. 2006), B. canis (Gökçe et al. 2013), and B. gibsoni (Aysul et al. 2013) in Turkey are available. Aktas et al. (2015b) determined B. canis prevalence as 0.1% (1/126) using PCR and reverse line blotting assays in Erzurum. This prevalence difference from this study (5.3% [7/133]) could be related to differences in the study population characteristics and analysis method. The first report of D. reticulatus was released a long time ago (Oytun 1947) from Central Anatolia, Turkey. The second report on this vector was from Kars province, which was also the first report of B. canis infection in dogs in Turkey (Gökçe et al. 2013). Kars and Erzurum are neighboring cities and have similar climatic conditions. The distribution of D. reticulatus expands in recent years (Rubel et al. 2016), suggesting that the tick is newly settled in eastern part of Turkey or noticed lately.

Hepatozoon canis is mainly transmitted by the brown dog tick (Rhipicephalus sanguineus s.l). H. canis is well adapted to its canine host and having low pathogenicity (1–5%) (Little et al. 2009, Baneth 2011). The parasite is prevalent in southern Europe, Asia, Africa, and South and North America with a prevalence of 7.5–52% (Rojas et al. 2014, Maia et al. 2015, Piratae et al. 2015, Hamel et al. 2016). The other agent of canine hepatozoonosis is Hericium americanum. It is transmitted by Amblyomma maculatum and is found only in the Southeastern United States (Little et al. 2009), and it is not expected to exist in Turkey or other old world countries. Due to vector distribution we considered all of the Hepatozoon spp. positive samples to be H. canis. In different parts of Turkey, the Hepatozoon spp. prevalence varies from 3.6% and 25.8% (Karagenc et al. 2006, Aktas et al. 2015a, Aydin et al. 2015). In the present study, the prevalence of Hepatozoon spp. and H. canis was 27.1% (36/133) and 5.3% (7/133), respectively. Aktas et al. (2015a) reported 42.8% positivity for H. canis in dogs in Erzurum. We used primers specific to Hepatozoon spp. and only 7 out of the 43 positive PCR products were sequenced and identified as H. canis.

Co-infection is reported to be a frequent event in dogs with CVBDs in endemic areas particularly those living outside and have possibility to come across with the vectors (Otranto et al. 2009). In agreement with several reports (Jittapalapong et al. 2006, Baneth 2011, Rojas et al. 2014, Maia et al. 2015), Hepatozoon spp. and H. canis were the most prevalent pathogens in single and mixed infections (Table 2). High infection rate of H. canis could be related to the widespread prevalence of its vector, R. sanguineus s.l. (Spolidorio et al. 2009, Rojas et al. 2014, Inci et al. 2016). This may explain high prevalence of Hepatozoon spp. in our study. However, other pathogens transmitted by R. sanguineus s.l. were absent (B. vogeli, B. gibsoni, and A. platys) or less prevalent (E. canis). Another explanation for high rate of H. canis positivity could be related to the fact that long parasitemia span of the parasite prolonged possibly further by the presence of other infectious agents (Götsch et al. 2009).

Zoonotic visceral leishmaniasis (VL) caused by Leishmania infantum (syn. Leishmania chagasi in New World) is a global problem and especially endemic in human and dogs of all countries bordering the Mediterranean Basin (Maia and Cardoso 2015). Dogs are main reservoirs and represent a significant risk factor for human VL (Maia and Cardoso 2015, Reguera et al. 2016). Canine leishmaniasis (CanL) is a serious disease, usually leads to death when untreated. CanL is commonly present in southern Europe, Africa, Asia, and Americas (Baneth et al. 2008, Reguera et al. 2016). CanL caused by L. infantum is a well-known problem in Turkey, and endemic throughout the Marmara, Aegean, Black Sea, and Mediterranean regions and also reported sporadically in other regions in Turkey (Ozbel et al. 2016). Phlebotomine sandflies, which are vectors of Leishmania spp, exist in more than 80 countries in the Old and New World (Depaquit et al. 2010). Ozbel (2013) reported that sand flies are present in all geographical regions of Turkey with different fauna composition.

The prevalence of the CanL was reported to be between 1% and 37% in Mediterranean basin countries (Maia and Cardoso 2015). The prevalence of CanL was reported to vary from 0% to 41.74% among dog populations in different areas of Turkey, in which Immunofluorescence Antibody Test (IFAT) or PCR techniques were used (Aktaş et al. 2010, Karakuş et al. 2015, Ozbel et al. 2016). In agreement with a report by Aktaş et al. (2010) who reported no seropositivity for Leishmania spp. by IFAT in 72 dogs in Erzurum, we did not detect Leishmania spp. DNA. This could be related to unsuitability of climatological conditions for its vector (Depaquit et al. 2010, Ozbel (2013). However, Buyukavci et al. (2005) conducted a study in Kars province located in eastern part of Turkey and revealed 21 VL human cases, of which the majority (66%) of the cases were from Kağızman district, a microclimate area of Kars. Another reason for negativity could be the tissue choice. In general, biopsy and aspiration from bone marrow, lymph nodes, and spleen, and also conjunctival, oral, and nasal swabs are preferred for PCR analysis. Whole blood or buffy coats can also be used but the sensitivity of the results is lower than tissues mentioned above (Paltrinieri et al. 2016).

Filaroids are vector-borne parasitic nematodes, prevalent worldwide especially in temperate, tropical, and subtropical climatic regions. Among them, D. immitis and D. repens are well-known species with increasing concern due to their effect on dogs and man. D. immitis causes cardiopulmonary dirofilariasis in dogs, cats, and wild mammals. Besides, it causes pulmonary dirofilariasis and subcutaneous dirofilariasis in humans mainly in the United States. D. repens parasitizes the subcutaneous and intramuscular connective tissue in dogs, but is a more prevalent zoonotic pathogen in man causing subcutaneous or ocular dirofilariasis especially in Europe. They are transmitted through the family Culicidae (Simón et al. 2012, Otranto et al. 2013). A. reconditum, another less pathogenic filarial agent, also has a global distribution and is the most prevalent filaroid species infecting dogs. Fleas or lice are the intermediate hosts of A. reconditum (Otranto et al. 2013).

Due to climatic and ecological changes mosquito and wild reservoir intensity and distribution of dirofilariasis expands, even in countries once considered free of the infection (Simón et al. 2012, Baneth et al. 2016). The prevalence of these three agents is 0–73.5% (Simón et al. 2012, Otranto et al. 2013, Ionică et al. 2015). The prevalence of filariasis, especially D. immitis in dogs from different regions of Turkey is 0–46.2% (Simsek et al. 2011, Taşçi and Kiliç 2012). Differences can be explained by the study region, dog type, vector population, and diagnostic method. In this study, prevalence of D. immitis was 1.5%, which was much lower than a previous study (8.1%) conducted in Erzurum (Simsek et al. 2011). Moreover, D. repens or A. reconditum DNA was not detected in this study. The prevalence of dirofilariasis is higher in coastal areas than in mountainous areas (Song et al. 2003, Simsek et al. 2008), suggesting that the weather is a critical factor affecting the prevalence of the vector and so the disease (Montoya et al. 1998). Life expectancy of mosquitos in Erzurum, with short summer times, is only 3–4 months. Although the intermediate hosts (i.e., fleas and lice of dogs) are widespread, we could not detect A. reconditum DNA. Propagation of dirofilariasis throughout the world is an accepted information and D. repens is reported to be a more rapidly spreading species than D. immitis (Ionică et al. 2015). However, there was no D. repens positivity in this study.

Ehrlichia and Anaplasma species cause ehrlichiosis and anaplasmosis, which are emerging zoonosis and mainly transmitted by ticks (Sainz et al. 2015). Among these bacteria, E. canis is the etiological agent of canine monocytic ehrlichiosis and A. platys causes canine infectious cyclic thrombocytopenia (Gaff et al. 2014). E. canis was identified from humans in Venezuela (Perez et al. 1996, 2006) and in Costa Rica (Bouza-Mora et al. 2017). The agent is transmitted mainly by R. sanguineus s. l., and has a global distribution, especially in the Mediterranean region (Dahmani et al. 2015, Carvalho et al. 2017). A. platys, a platelet-specific microorganism causing thrombocytopenia, is potentially transmitted by R. sanguineus s.l. (Gaff et al. 2014). Worldwide, A. platys infection in dogs has been reported (Ulutas et al. 2007, Dahmani et al. 2015, Carvalho et al. 2017). Also, human cases of A. platys were confirmed in Venezuela and USA (Arraga-Alvarado et al. 2014, Dahmani et al. 2015).

The prevalence of E. canis and A. platys varies from 0.5% to 38.4% and 0.4% to 48.78%, respectively (Dahmani et al. 2015, Çetinkaya et al. 2016, Hamel et al. 2016). In Turkey, their prevalence is up to 69.4% depending on the region (Düzlü et al. 2014, Aktas et al. 2015b, Çetinkaya et al. 2016). In present study, the positivity rate was 9.8% for E. canis and 0% for A. platys. This study is the first report of E. canis positivity in dogs in Erzurum. In the previous study in Erzurum, Aktas et al. (2015b) did not report positivity of E. canis in asymptomatic dogs. In parallel with our result, Inpankaew et al. (2016) could not find A. platys despite E. canis positivity (21.8%). Karagenç et al. (2005) reported high prevalence both for E. canis (41.5%) and A. platys (39.4%) in the Aegean region of Turkey. Düzlü et al. (2014) reported 15% E. canis prevalence in dogs in Kayseri, Turkey. Lower prevalence was also reported for E. canis and A. platys as 4% and 3.25%, respectively in the Thrace region of Turkey (Çetinkaya et al. 2016). The vector of these two bacteria, R. sanguineus s.l., is very common in all regions of Turkey (Inci et al. 2016). The regions of Turkey have different climatic conditions that affect survival of vectors, which may explain the difference in prevalence (Dahmani et al. 2015). Thus, the positivity rate appears to be related to differences in the study population (pet dogs vs. stray dogs) (Piratae et al. 2015) and experimentation season (Dahmani et al. 2015).

Conclusion

B. canis (5.3%), Hepatozoon spp. (27.1%), H. canis (5.3%), D. immitis (1.5%), and E. canis (9.8%) were detected via PCR in stray dogs in Erzurum, Northeastern Turkey. This study is the first report on presence of E. canis in this area. Of the vector-borne agents identified in stray dogs in Erzurum, D. immitis and E. canis are considered zoonotic, ascertaining the role of stray dogs as reservoirs for CVB pathogens. Vector control applications, examination, and treatment for CVBP in stray dogs should be considered to decrease their prevalence.

Footnotes

Acknowledgment

This study was supported by Ataturk University Scientific Researches Projects (project no. BAP-2012-54).

Author Disclosure Statement

No competing financial interests exist.

References

Aktas

, Özübek

, Altay

, Balkaya

, et al. A molecular and parasitological survey of Hepatozoon canis in domestic dogs in Turkey. Vet Parasitol, 2015a; 209:264–267.

Aktas

, Özübek

, Altay

, Ipek

, et al. Molecular detection of tick-borne rickettsial and protozoan pathogens in domestic dogs from Turkey. Parasit Vectors, 2015b; 8; 157.

Aktaş

, Özkanlar

, Özkan

, Babür

, et al. Erzurum İli Barınak Köpeklerinde Listeriosis ve Leishmaniasisin Seroprevalansının Araştırılması. Türkiye Parazitol Derg, 2010; 34:76–80.

Arraga-Alvarado

, Qurollo

, Parra

, Berrueta

, et al. Case report: Molecular evidence of Anaplasma platys infection in two women from Venezuela. Am J Trop Med Hyg, 2014; 91:1161–1165.

Aydin

, Sevinc

. Molecular detection and characterization of Hepatozoon spp. in dogs from the central part of Turkey. Ticks Tick-Borne Dis, 2015; 6:388–392.

Aysul

, Ural

, Ulutaş

, Eren

, et al. First detection and molecular identification of Babesia gibsoni in two dogs from the Aydın Province of Turkey. Turk J Vet Anim Sci, 2013; 37:226–229.

Baneth

, Bourdeau

, Bourdoiseau

, Bowman

, et al. Vector-borne diseases-constant challenge for practicing veterinarians: Recommendations from the CVBD World Forum. Parasit Vectors, 2012; 5:55.

Baneth

, Koutinas

, Solano-Gallego

, Bourdeau

, et al. Canine leishmaniosis –new concepts and insights on an expanding zoonosis: Part one. Trends Parasitol, 2008; 24:324–330.

Baneth

, Thamsborg

, Otranto

, Guillot

, et al. Major parasitic zoonoses associated with dogs and cats in Europe. J Comp Pathol, 2016; 155:54–74.

10.

Baneth

. Perspectives on canine and feline hepatozoonosis. Vet Parasitol, 2011; 181:3–11.

11.

Bouza-Mora

, Dolz

, Solórzano-Morales

, Romero-Zuniga

, et al. Novel genotype of Ehrlichia canis detected in samples of human blood bank donors in Costa Rica. Ticks Tick-Borne Dis, 2017; 8:36–40.

12.

Buyukavci

, Karacan

, Tan

, Akdag

. Visceral childhood leishmaniasis in Kağızman, eastern Turkey: A new endemic area. Ann Trop Paediatr, 2005; 25:41–43.

13.

Carvalho

, Wenceslau

, Carlos

, Albuquerque

. Epidemiological and molecular study of Ehrlichia canis in dogs in Bahia, Brazil. Genet Mol Res, 2008; 7:657–662.

14.

Carvalho

, Armua-Fernandez

, Sosa

, Félix

, et al. Anaplasma platys in dogs from Uruguay. Ticks Tick-Borne Dis, 2017; 8:241–245.

15.

Çetinkaya

, Matur

, Akyazi İ, Ekiz

, et al. Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of Turkey. Ticks Tick-Borne Dis, 2016; 7:706–714.

16.

Dahmani

, Loudahi

, Mediannikov

, Fenollar

, et al. Molecular detection of Anaplasma platys and Ehrlichia canis in dogs from Kabylie, Algeria. Ticks Tick-Borne Dis, 2015; 6:198–203.

17.

Depaquit

, Grandadam

, Fouque

, Andry

, et al. Arthropod-borne viruses transmitted by Phlebotomine sandflies in Europe: review. Euro Surveill, 2010; 15:19507.

18.

Düzlü

, İnci

, Yıldırım

, Önder

, et al. Köpeklerde kene kaynaklı bazı protozoon ve rickettsial enfeksiyonların Real Time PCR ile araştırılması ve saptanan izolatların moleküler karakterizasyonları. Ankara Univ Vet Fak Derg, 2014; 61:275–282.

19.

Gaff

, Kocan

, Sonenshine

. Tick-borne rickettsiois II (Anaplasmataceae). In: Sonenshine

D.E.

, Roe

R.M.

eds. Biology of Ticks. Oxford University Press, Oxford, New York, 2014:251–277.

20.

Gökçe

, Kirmizigül

, Taşçi

, Uzlu

, et al. Türkiye'de köpeklerde Babesia canis canis'in klinik ve parazitolojik olarak ilk tespiti. Kafkas Univ Vet Fak Derg, 2013; 19:717–720.

21.

Götsch

, Leschnik

, Duscher

, Burgstaller

, et al. Ticks and haemoparasites of dogs from Praia, Cape Verde. Vet Parasitol, 2009; 166:171–174.

22.

Gülanber

, Gorenflot

, Schetters

, Carcy

. First molecular diagnosis of Babesia vogeli in domestic dogs from Turkey. Vet Parasitol, 2006; 139:224–230.

23.

Hamel

, Shukullari

, Rapti

, Silaghi

, et al. Parasites and vector-borne pathogens in client-owned dogs in Albania. Blood pathogens and seroprevalences of parasitic and other infectious agents. Parasitol Res, 2016; 115:489–499.

24.

Inci

, Yildirim

, Duzlu

, Doganay

, et al. Tick-borne diseases in Turkey: A review based on one health perspective. PLoS Negl Trop Dis, 2016; 10:e0005021.

25.

Inokuma

, Ohno

, Onishi

, Raoult

, et al. Detection of ehrlichial infection by PCR in dogs from Yamaguchi and Okinawa Prefectures, Japan. J Vet Med Sci, 2001; 63:815–817.

26.

Inokuma

, Okuda

, Ohno

, Shimoda

, et al. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet Parasitol, 2002; 106:265–271.

27.

Inokuma

, Yoshizaki

, Shimada

, Sakata

, et al. Epidemiological survey of Babesia species in Japan performed with specimens from ticks collected from dogs and detection of new Babesia DNA closely related to Babesia odocoilei and Babesia divergens DNA. J Clin Microbiol, 2003; 41:3494–3498.

28.

Inokuma

, Yoshizaki

, Matsumoto

, Okuda

, et al. Molecular survey of Babesia infection in dogs in Okinawa, Japan. Vet Parasitol, 2004; 121:341–346.

29.

Inpankaew

, Hii

, Chimnoi

, Traub

. Canine vector-borne pathogens in semi-domesticated dogs residing in northern Cambodia. Parasit Vectors, 2016; 9:253.

30.

Ionică

, Matei

, Mircean

, Dumitrache

, D'Amico

, et al. Current surveys on the prevalence and distribution of Dirofilaria spp. and Acanthocheilonema reconditum infections in dogs in Romania. Parasitol Res, 2015; 114:975–982.

31.

Jittapalapong

, Rungphisutthipongse

, Maruyama

, Schaefer

, et al. Detection of Hepatozoon canis in stray dogs and cats in Bangkok, Thailand. Ann N Y Acad Sci, 2006; 1081:479–488.

32.

Karagenç

, Hoşgör

, Bilgiç

, Paşa

, et al. The determination of the prevalence of E. canis, A. phagocytophilum and A. platys with nested PCR in dogs in the Aegean Region, Izmir, Turkey. In: 14th National Parasitology Congress, September 18–25, 2005, İzmir, Turkey, pp. 270–271.

33.

Karagenc

, Pasa

, Kirli

, Hosgor

, et al. A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Vet Parasitol, 2006; 135:113–119.

34.

Karakuş

, Töz

, Ertabaklar

, Paşa

, et al. Evaluation of conjunctival swab sampling in the diagnosis of canine leishmaniasis: A two-year follow-up study in Çukurova Plain, Turkey. Vet Parasitol, 2015; 214:295–302.

35.

Karbowiak

. The occurrence of the Dermacentor reticulatus tick-its expansion to new areas and possible causes. Ann Parasitol, 2014; 60:37–47.

36.

Little

, Allen

, Johnson

, Panciera

, et al. New developments in canine hepatozoonosis in North America: A review. Parasit. Vectors, 2009; Suppl 1:S5.

37.

Maia

, Almeida

, Coimbra

, Fernandes

, et al. Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasit Vectors, 2015; 8:138.

38.

Maia

, Cardoso

. Spread of Leishmania infantum in Europe with dog travelling. Vet Parasitol, 2015; 213:2–11.

39.

Matijatko

, Torti

, Schetters

. Canine babesiosis in Europe: How many diseases?. Trends Parasitol, 2012; 28:99–105.

40.

Montoya

, Morales

, Ferrer

, Molina

, et al. The prevalence of Dirofilaria immitis in Gran Canaria, Canary Islands, Spain (1994–1996). Vet Parasitol, 1998; 75:221–226.

41.

Murphy

, Ewing

, Whitworth

, Fox

, et al. A molecular and serologic survey of Ehrlichia canis, E. chaffeensis, and E. ewingii in dogs and ticks from Oklahoma. Vet Parasitol, 1998; 79:325–339.

42.

Otranto

, Dantas-Torres

, Breitschwerdt

. Managing canine vector-borne diseases of zoonotic concern: Part two. Trends Parasitol, 2009; 25:228–235.

43.

Otranto

, Dantas-Torres

, Brianti

, Traversa

, et al. Vector-borne helminths of dogs and humans in Europe. Parasit Vectors, 2013; 6:16.

44.

Oytun

. Keneler, Zararlari ve Savas Careleri. YZE Basimevi, Ankara, 1947:109.

45.

Ozbel

, Karakuş

, Arserim

, Kalkan

ŞO

, et al. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyia dentata in a focus of human and canine leishmaniasis in western Turkey. Acta Trop, 2016; 155:89–94.

46.

Ozbel

. The infections transmitted by Sand flies in Turkey. Ankara Üniv Vet Fak Derg, 2013; 60:225–228.

47.

Paltrinieri

, Gradoni

, Roura

, Zatelli

, et al. Laboratory tests for diagnosing and monitoring canine leishmaniasis. Vet Clin Pathol, 2016; 45:552–578.

48.

Perez

, Bodor

, Zhang

, Xiong

, et al. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y Acad Sci, 2006; 1078:110–117.

49.

Perez

, Rikihisa

, Wen

. Ehrlichia canis-like agent isolated from a man in Venezuela: Antigenic and genetic characterization. J Clin Microbiol, 1996; 34:2133–2139.

50.

Piratae

, Pimpjong

, Vaisusuk

, Chatan

. Molecular detection of Ehrlichia canis, Hepatozoon canis and Babesia canis vogeli in stray dogs in Mahasarakham province, Thailand. Ann Parasitol, 2015; 61:183–187.

51.

Reguera

, Morán

, Pérez-Pertejo

, García-Estrada

, et al. Current status on prevention and treatment of canine leishmaniasis. Vet Parasitol, 2016; 227:98–114.

52.

Rishniw

, Barr

, Simpson

, Frongillo

, et al. Discrimination between six species of canine microfilariae by a single polymerase chain reaction. Vet Parasitol, 2006; 135:303–314.

53.

Rojas

, Rojas

, Montenegro

, Gutiérrez

, et al. Vector-borne pathogens in dogs from Costa Rica: First molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection. Vet Parasitol, 2014; 199:121–128.

54.

Rubel

, Brugger

, Pfeffer

, Chitimia-Dobler

, et al. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick-borne Dis, 2016; 7, 224–233.

55.

Sainz

, Roura

, Miro

, Estrada-Pena

, et al. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasit Vectors, 2015; 8:75.

56.

Simón

, Siles-Lucas

, Morchón

, González-Miguel

, et al. Human and animal dirofilariasis: The emergence of a zoonotic mosaic. Clin Microbiol Rev, 2012; 25:507–544.

57.

Simsek

, Ozkanlar

, Balkaya

, Aktas

. Microscopic, serologic and molecular surveys on Dirofilaria immitis in stray dogs, Turkey. Vet Parasitol, 2011; 183:109–113.

58.

Simsek

, Utuk

, Koroglu

, Rishniw

. Serological and molecular studies on Dirofilaria immitis in dogs from Turkey. J Helminthol, 2008; 82:181–186.

59.

Solano-Gallego

, Sainz Á, Roura

, Estrada-Peña

, et al. A review of canine babesiosis: The European perspective. Parasit Vectors, 2016; 9:336.

60.

Song

, Lee

, Hayasaki

, Shiramizu

, et al. Seroprevalence of canine dirofilariosis in South Korea. Vet Parasitol, 2003; 114:231–236.

61.

Spolidorio

, Labruna

, Zago

, Donatele

, et al. Hepatozoon canis infecting dogs in the State of Espírito Santo, southeastern Brazil. Vet Parasitol, 2009; 163:357–361.

62.

Taşçi

, Kiliç

. Kars ve Iğdır Civarındaki Köpeklerde Dirofilaria immitis (Leidy, 1856)'nin Prevalansı ve Potansiyel Vektör Sivrisinek Türleri Üzerine Araştırmalar. Kafkas Univ Vet Fak Derg, 2012; 18:29–34.

63.

Uilenberg

. Babesia-a historical overview. Vet Parasitol, 2006; 138:3–10.

64.

Ulutas

, Bayramli

, Karagenc

. First case of Anaplasma (Ehrlichia) platys infection in a dog in Turkey. Turk J Vet Anim Sci, 2007; 31:279–282.

65.

van Eys

, Schoone

, Kroon

, Ebeling

. Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification of Leishmania parasites. Mol Biochem Parasitol, 1992; 51:133–142.