Investigation on Mosquito-Borne Viruses at Lancang River and Nu River Watersheds in Southwestern China

Abstract

During 2007 and 2010, an extensive entomological survey was performed to assess the distribution of mosquitoes and mosquito-borne arboviruses at Lancang River and Nu River watersheds in southwestern China. A total of 20,450 mosquitoes consisting 20 species was trapped and submitted 261 pools according to species and location. Culex tritaeniorhynchus and Anopheles sinensis were the most abundant species. Eighty-seven isolates representing 11 virus species in 8 genera were obtained from 6 mosquito species. The new isolates were identified as Getah virus (GETV), Japanese encephalitis virus (JEV), Yunnan Culex-related flavivirus (YNCxFV), Yunnan Aedes-related flavivirus (YNAeFV), Banna virus (BAV), Yunnan orbivirus (YUOV), Banna orbivirus (BAOV), Yunnan totivirus (YNToV), Nam Dinh virus (NDiV), Menghai rhabdovirus (MRV), and Anopheles minimus iridovirus (AMIV). These viruses included confirmed or potential pathogen of human disease, such as JEV, BAV, and NDiV, and several novel or reassortant arboviruses, such as YNAeFV, MRV, AMIV, and BAOV. GETV, JEV, YNCxFV, and NDiV were widely prevalent in the whole basin of the two rivers. The findings contribute to our understanding of the diversity and wide distribution of mosquito-borne arboviruses in the area, and are helpful to explore pathogenic evidence for fevers and viral encephalitis of unknown etiology.

Introduction

Arboviruses are maintained in nature in cycles involving hematophagous arthropod vectors, such as mosquitoes and ticks, and susceptible vertebrate hosts (Karabatsos 1978, Liang et al. 2015). More than 550 arboviruses have been identified in the world, among which over 130 virus species are pathogens in human beings or susceptible vertebrate hosts (Gao et al. 2010, Liu et al. 2011). Arboviruses cause significant human illness ranging from mild, asymptomatic infection to fatal encephalitis or hemorrhagic fever (Liang et al. 2015). Traditionally, four principal arboviruses, including Japanese encephalitis virus (JEV), dengue virus serotype 1–4, tick-borne encephalitis virus, and Xinjiang hemorrhagic fever virus (also known as Crimean–Congo hemorrhagic fever virus) are circulating in human population in mainland China (Lu et al. 2008, Wang et al. 2009a, Gao et al. 2010, Zhang and Liang 2012). In addition, several imported vector-borne diseases have been reported in China recently, such as yellow fever and Zika (Chen et al. 2016, Wang et al. 2016, Yin et al. 2016, Li et al. 2017).

In recent 30 years, nearly 20 new arboviruses have been isolated and identified from field materials or patients and at least 10 new species of viruses originated from the Yunnan Province (Gao et al. 2010, Liu et al. 2011, Wang et al. 2011). These virus species related to six genera belonging to five families of virus, including Chikungunya virus, Sindbis virus, and Getah virus (GETV) of genus Alphavirus, Kyasanur forest disease virus of genus Flavivirus, Kadipiro virus, and Banna virus (BAV) of genus Seadornavirus, Batai virus of genus Orthobunyavirus, Yunnan orbivirus (YUOV) of genus Orbivirus, and Culex pipiens pallens densovirus of genus Densovirus (Table 1). In addition, fevers and viral encephalitis of unknown etiological agents are reported annually during the mosquito activity season in Yunnan Province (Wang et al. 2011).

Table 1.

Summary of Mosquito-Borne Viruses Found in Yunnan Province in Recent Years

Virus	Taxonomy	Source	Time	Reference
Chikungunya virus	Genus Alphavirus	Bat brain	1986	Zhang et al. (1989)
Chikungunya virus	Family Togaviridae	Bat brain	1986	Zhang et al. (1989)
Sindbis virus	Genus Alphavirus	Patient serum	1987	Liang et al. (2000)
Sindbis virus	Family Togaviridae	Patient serum	1987	Liang et al. (2000)
Getah virus	Genus Alphavirus	Mosquito	2005	Zhai et al. (2008b)
Getah virus	Family Togaviridae	Mosquito	2005	Zhai et al. (2008b)
Kyasanur forest disease virus	Genus Flavivirus	Patient serum	1989	Wang et al. (2009b)
Kyasanur forest disease virus	Family Flaviviridae	Patient serum	1989	Wang et al. (2009b)
Banna virus	Genus Seadornavirus	Patient serum	1987	Xu et al. (1990)
Banna virus	Family Reoviridae	Patient serum	1987	Xu et al. (1990)
Kadipiro virus	Genus Seadornavirus	Mosquito	2005	Sun et al. (2009b)
Kadipiro virus	Family Reoviridae	Mosquito	2005	Sun et al. (2009b)
Batai virus	Genus Orthobunyavirus	Mosquito	1998	Fu et al. (2005)
Batai virus	Family Bunyaviridae	Mosquito	1998	Fu et al. (2005)
Yunnan orbivirus	Genus Orbivirus	Mosquito	1988	Attoui et al. (2005)
Yunnan orbivirus	Family Reoviridae	Mosquito	1988	Attoui et al. (2005)
Culex pipiens pallens densovirus	Genus Densovirus	Culex pipiens pallens	2008	Zhai, et al. (2008a)
	Subfamily Densovirinae
	Family Parvoviridae

The Lancang River and Nu River run through north and south of the western Yunnan Province locating in southwestern China. The Lancang River, known as section of Lancang-Mekong River in China, runs for 1227 km in Yunnan Province. Lancang-Mekong River, dubbed as the “Danube of the East,” is a unique international river and an important trade route connecting the southwestern China to five countries of southeastern Asia, including Myanmar, Laos, Thailand, Cambodia, and Vietnam (Feng et al. 2013, Ejiri et al. 2014). The two river basins, with over 10 million of the population, are main areas of Hengduan Mountains with complex geographical features in southwestern China, the terrain of which is broken and steep (Zhang et al. 2001). Additionally, the Lancang River and Nu River watershed is one of the richest areas of global biodiversity and ecological landscape reservation, which has a tropical to subtropical climate and is one of the core and key areas of the mosquito fauna and species distribution, supporting circulation of numerous arthropod-borne viruses (arboviruses) (Wang et al. 2009c, Zhang et al. 2013).

However, previous studies mainly focused on south and southwest of the two river basins with lower elevation or southern border areas to date, such as Xishuangbanna region and the China–Myanmar–Laos border (Tao et al. 2003, Zhou et al. 2009, Wang et al. 2011, Feng et al. 2012, 2014). Few investigations on mosquitoes and mosquito-borne viruses were performed in northwestern Yunnan Province (Sun et al. 2009a). With global warming, population mobility increasing, people's production and lifestyle changing, particularly the Lancang-Mekong River international shipping, it is necessary to enhance investigation on distributions of mosquitoes and mosquito-borne viruses in the two river basins. In the present study, we performed an extensive entomological survey during 2007 and 2010 to provide preliminary information regarding the presence and distribution of mosquito-borne viruses and to understand potential arboviral diseases in this region.

Materials and Methods

Sample collection

From 2007 to 2010, sampling of mosquitoes was conducted at 19 counties or cities along the Lancang River and Nu River watersheds in Yunnan Province during the mosquito activity season (from June to September). The Lancang River locates in latitude 21°56′ N to 28°72′ N, longitude 98°69′ E to 101°15′ E in Yunnan Province. The Nu River locates in latitude 24°07′ N to 28°23′ N, longitude 98°07′ E to 100°02′ E in Yunnan Province and runs for 618 km. The sampling sites were chosen between latitude 21°94′ N and 27°37′ N and longitude 97°67′ E and 101°99′ E with an altitude range from 545 to 2536 m. The sampling sites included 5 in upper reach (altitude from 841 to 2536 m) of the Lancang River, 10 in middle reach (altitude from 751 to 1477 m), and 4 in lower reach (altitude from 545 m to 1 064 m) (Fig. 1). Each site was sampled overnight or for 12 h during daytime. Mosquitoes at night were collected from cattle pens, hog pens, or hen houses using light traps (version CDC, LTS-M02B, Kongfu Dude, Wuhan JiXing Medical Technology, Co., Ltd.) baited with CO₂. Mosquitoes during daytime were collected with mosquito suction devices by investigator in the mosquito nets. Collected mosquitoes were frozen at −20°C for 30 min and mosquito species were identified on an ice plate under the anatomical lens. The blood-fed and male mosquitoes were excluded. The mosquito samples were then grouped on the basis of collection site and mosquito species. A group of ∼200 mosquitoes was handled as one mosquito pool and stored in liquid nitrogen until test.

FIG. 1.

Sampling sites of mosquitoes in different reaches of Yunnan Lancang River and Nu River. Quadrate, roundness, and triangle represent upper, middle, and lower reach, respectively.

Viral isolation

Each mosquito pool was removed from the liquid nitrogen and immediately homogenized with RPMI-1640 medium containing 2% fetal calf serum and centrifuged. The supernatant was filtered through a 0.22 μm Millipore filter (25 mm diameter) and added to a 25-cm²flask with Aedes albopictus C6/36 cells and cultured at 32°C with 5% CO₂ for 7–10 days. The cells were examined daily for evidence of a virally induced cytopathic effect (CPE). The culture supernatant was then filtered with the 0.22 μm filter and was blind passaged three times. A specimen was recognized as a positive isolate if it caused CPE in three successive cell passages.

Viral identification and nucleotide sequencing

Infected cell culture supernatant was harvested and identified by RT-PCR. Briefly, total RNA was extracted from the culture using the QIAamp Viral RNA Kit (QIAGEN, USA) according to the manufacturer's instructions, and then was reverse transcribed with a random hexamers to obtain the first-strand complementary DNA. Positive isolates were identified by PCR methods with genus- or species-specific primers (Table 2). A semi-nested PCR was first performed using JEV-specific primers (J1–J3, J2–J3) to screen JEV. Positive isolates for JEV nucleotide were further amplified for full envelope (E) gene of the virus with a pair of primers EF and ER. Specimen negative for JEV was tested by PCR with genus-specific primers, such as FU1 and CFD2 for Flavivirus, M2w and cMw3 for Alphavirus, as well as species-specific primers to detect BAV, YUOV, and Omono River virus (ORV). PCR products were directly sequenced using an automated DNA sequencer (ABI PRISM 373; PerkinElmer, USA). The DNA was sequenced using both forward and reverse primers to verify the sequences. The sequences were subjected to a BLAST search to compare with the GenBank database.

Table 2.

Primers Used for Identification of Positive Isolates in This Study

Primer	Sequence (5′ to 3′)	Target	Region	Size (bp)	Reference
M2w	YAGAGCDTTTTCGCAYSTRGCHW	Alphavirus	NS1	434	Pfeffer et al. (1997)
cMw3	CATRAANKGNGTNGTRTCRAANCCDAYCC	Alphavirus	NS1	434	Pfeffer et al. (1997)
J1	GTGCCATTGACATCACAAG	JEV	NS1	409	Guo et al. (2001)
J3	TGTCTCA GGTCCA TCTACG	JEV	NS1	409	Guo et al. (2001)
J2	TCTGGGAACCCGTACGGGAC	JEV	NS1	219	Guo et al. (2001)
J3	TGTCTCA GGTCCA TCTACG	JEV	NS1	219	Guo et al. (2001)
EF	TGYTGGTCGCTCCGGCTTA	JEV	E	1663	Obara et al. (2011)
ER	AAGATGCCACTTCCACAYCTC	JEV	E	1663	Obara et al. (2011)
FU1	TACAACATGATGGGAAAGAGAGAGAA	Flavivirus	NS5	265	Kuno et al. (1998)
CFD2	GTGTCCCAGCCGGCGGTGTCATCAGC	Flavivirus	NS5	265	Kuno et al. (1998)
12-854-S	AAATTGATAGYGYTTGCGTAAGAG	BAV	S12	845	Billoir et al. (1999)
12-B2-R	GTTCTAAATTGGATACGGCGTGC	BAV	S12	845	Billoir et al. (1999)
YUOVS7F	AGCATTCGGTACGCAGTATCTCG	YUOV	—	470	Attoui et al. (2005)
YUOVS7R	GCCGAGCCGATCATGTCACGTGT	YUOV	—	470	Attoui et al. (2005)
ORV5442F	ACCTACGCTACCAAGATGGCCA	ORV	RdRp	483	Fu (2012)
ORV5949R	GATACGCCTCGATGTTGCTGGCT	ORV	RdRp	483	Fu (2012)

BAV, Banna virus; E, envelope protein; JEV, Japanese encephalitis virus; NS, nonstructural protein; ORV, Omono River virus; RdRp, RNA-dependent RNA polymerase; S, small segment; YUOV, Yunnan orbivirus.

If new isolate was not identified using the above strategy, total RNA was extracted from the filtered supernatant using the High Pure Viral RNA Kit (Roche, Switzerland) according to the manufacturer's instructions. A sequencing library was constructed using an Ion Total RNA-Seq Kit v2 (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. High-throughput sequencing was performed using an Ion Torrent Personal Genome Machine (Thermo Fisher Scientific) to obtain complete sequence of the isolates.

Results

Mosquito collection

A total of 20,450 mosquitoes representing 20 species, belonging to the Culex (Cx.), Aedes (Ae.), Anopheles (An.), and Armigeres (Ar.) genera, was trapped. As shown in Figure 2, Cx. tritaeniorhynchus was the dominant species, accounting for 77.24% of the total, followed by An. sinensis (13.70%), Ae. albopictus (2.30%), Ar. subalbatus (1.15%), and Ae. vexans (1.10%). Less abundant species (under 1%) were Cx. fuscocephalus, An. kunmingensis, Cx. annulus (1.0–0.5%); An. minimus, Cx. quinquefasciatus, Cx. gelidus, An. kochi, An. vagus, Ae. aegypti, Cx. whitmorei (0.5–0.1%); An. tessellates, An. barbirostris, Ae. annandalei, and An. peditaeniatus (under 0.1%). Five mosquito species were trapped in upstream and 13 in midstream and downstream each. There were 2678, 11,585, and 6187 mosquitoes in upper, middle, and lower reaches, respectively. The dominant species for each area were Cx. tritaeniorhynchus and An. sinensis species mosquito, which were similar with that in the whole watershed.

FIG. 2.

Constituent condition of mosquito species collected in the total and different reaches of Yunnan Lancang River and Nu River. *“Others” represents mosquito species <1% of the mosquitoes.

Virus isolation and identification

All mosquitoes collected were submitted in 261 pools according to species, location, and date of collection for viral isolation. A total of 87 isolates was obtained from the 19 sites. Positive rate of viral isolation and minimum infectious rate were about 33.33% (87/261) and 4.25‰ (87/20,450), respectively. All 87 isolates showed obvious CPE on C6/36 cells, and 85 of them had been identified.

When the RT-PCR was used, 29 isolates were identified as JEV, and 17 were positive using universal primers of Flavivirus. After sequencing the PCR products, 11 and 6 isolates were identified as Culex- and Aedes-related flavivirus, tentatively named as Yunnan Culex flavivirus (YNCxFV) and Yunnan Aedes flavivirus (YNAeFV), respectively. Five isolates were positive with about 400-bp for RT-PCR using universal primers of Alphavirus (M2w-cMw3) and identified as GETV by blast search. Using the virus-specific primers, eight and six isolates were identified as BAV and YUOV, respectively. Two isolates were identified as totivirus-related virus, tentatively named as Yunnan totivirus (YNToV) with ORV-specific primers. Surprisingly, when BAV-specific primers were used, a positive product was obtained in an isolate from Cx. tritaeniorhynchus. Its nucleotide sequence was found similar to an insect nidovirus Nam Dinh virus (NDiV) reported in Vietnam in 2011.

When high-throughput sequencing was used, six isolates were identified as YNCxFV; one isolate from An. minimus mosquitoes was identified as a member of iridovirus, named as Anopheles minimus iridovirus (AMIV); and one isolate from Cx. tritaeniorhynchus mosquitoes trapped from Xishuangbanna region was identified as Tibet orbivirus (TiBOV)-related virus, named as Banna orbivirus (BAOV). In addition, for five positive pools, two viruses were simultaneously detected. YNAeFV and a member of family Rhabdoviridae, named as Menghai rhabdovirus (MRV), were included in three pools; one pool included both MRV and YNCxFV; another pool included both NDiV and YNCxFV. Sequences of the representative isolates have been submitted to GenBank, and the details are listed in Table 3. Thus, the newly identified isolates were related 11 virus species belonging to 8 genera of virus, including GETV (Alphavirus); JEV, YNCxFV, and YNAeFV (Flavivirus); BAV (Seadornavirus); YUOV and BAOV (Orbivirus); YNToV (Totivirus); NDiV (Alphamesonivirus 1); MRV (Rhabdoviridae); and AMIV (Iridovirus) (Fig. 3).

FIG. 3.

Number of virus isolates obtained in the present investigation based on virus genera and species. AMIV, Anopheles minimus iridovirus; BAOV, Banna orbivirus; BAV, Banna virus; GETV, Getah virus; JEV, Japanese encephalitis virus; MRV, Menghai rhabdovirus; NDiV, Nam Dinh virus; YNAeFV, Yunnan Aedes-related flavivirus; YNCxFV, Yunnan Culex-related flavivirus; YNToV, Yunnan totivirus; YUOV, Yunnan orbivirus.

Table 3.

List of GenBank Accession Information of the New Isolates in This Study

Virus	GenBank acc. no.	Mosquito species	Sampling time
GETV	KP900941-KP900945	Cx. tritaeniorhynchus, An. sinensis	2009
JEV	HM204527-HM204529	Cx. tritaeniorhynchus, An. sinensis	2007–2009
YNCxFV	KC510663-KC510673, NC_021069	Cx. tritaeniorhynchus, An. sinensis	2007–2009
YNAeFV	KU201526, KX907452	Cx. tritaeniorhynchus, Ae. albopictus, unidentified Aedes	2010
BAV	Not submitted	Cx. tritaeniorhynchus, An. sinensis	2007–2009
YUOV	Not submitted	Cx. tritaeniorhynchus, An. sinensis	2009
NDiV	KF771866	Cx. tritaeniorhynchus, An. sinensis, Ae. Annandalei	2009–2010
AMIV	KF938901	An. Minimus	2007
MRV	KX785335	Cx. tritaeniorhynchus, Ae. albopictus	2010
YNToV	KX456218	Cx. tritaeniorhynchus	2009
BAOV	KX455487-KX455496	Cx. tritaeniorhynchus	2007

AMIV, Anopheles minimus iridovirus; BAOV, Banna orbivirus; GETV, Getah virus; MRV, Menghai rhabdovirus; NDiV, Nam Dinh virus; YNAeFV, Yunnan Aedes-related flavivirus; YNCxFV, Yunnan Culex-related flavivirus; YNToV, Yunnan totivirus.

Distribution of the new isolates

The spatial distribution of the new isolates is summarized in Figure 4. Six (22 strains), nine (41 strains), and seven (24 strains) mosquito-borne virus species were isolated in upper, middle, and lower reaches in the survey area, respectively. GETV, JEV, YNCxFV, and NDiV were isolated from the whole basin of the Lancang River and Nu River. YUOV, BAV, and MRV were obtained from two reaches. AMIV and YNToV were only isolated from middle, and YNAeFV and BAOV were only isolated from the downstream.

FIG. 4.

Distribution of new isolates in Yunnan Lancang River and Nu River watershed.

The new isolates were obtained from six mosquito species, including Cx. tritaeniorhynchus, An. sinensis, An. minimus, Ae. albopictus, Ae. Annandalei, and an unidentified Aedes species. Cx. tritaeniorhynchus was detected to carry most of the species of the virus, including GETV, JEV, YNCxFV, BAV, YUOV, YNToV, NDiV, and BAOV, followed by An. sinensis with GETV, JEV, YNCxFV, BAV, and YUOV. These 2 mosquito species carried most of the 11 virus species other than YNAeFV and AMIV. Of the 87 isolates, 62 were from Cx. tritaeniorhynchus, and 14 from An. sinensis (Table 4).

Table 4.

The Details of the Newly Obtained Viruses by Mosquito Species from Which Arboviruses Were Isolated

Mosquito species	No. mosquito	No. Pool	No. isolate	Details of isolates ^*
Cx. tritaeniorhynchus	15,795	158	62	4 GETV, 24 JEV, 17 YNCxFV, 4 BAV, 2 NDiV, 1 BAOV, 5 YUOV, 1 MRV, 2 YNToV, 2 unknown
An. sinensis	2802	55	14	1 GETV, 5 JEV, 2 YNCxFV, 4 BAV, 1 YUOV, 1 NDiV
Ae. albopictus	472	6	7	4 YNAeFV, 3 MRV
Unidentified Aedes	73	2	2	2 YNAeFV
An. minimus	100	1	1	1 AMIV
Ae. annandalei	10	1	1	1 NDiV
Total	19,252	223	87

In this column, figures before the capital letter represent number of the new isolates.

Discussion

In the present study, 20 mosquito species were trapped in Yunnan Lancang River and Nu River watersheds. Cx. tritaeniorhynchus mosquito was the dominant species, followed by An. sinensis and Ae. albopictus. Five mosquito species were found in the upper reach and 13 in the middle and lower reach each. It is consistent with the previous study that the mosquito species increased with drop in latitude (Tao et al. 2003, Gong et al. 2005). From these mosquito samples, we obtained 11 species of arboviruses related to 8 virus families. Five virus species were first reported (their molecular characteristics published elsewhere), including three insect-related flaviviruses YNCxFV (Zuo et al. 2014), two insect-related flaviviruses YNAeFVs (Fan et al. 2016, Zhang et al. 2017), a novel iridovirus (Huang et al. 2015), a novel mosquito-borne rhabdovirus (Sun et al. 2017), and a novel reassortant Tibet orbivirus (Xing et al. 2017). Together with previous investigation data, over half of newly found arboviruses in China originated from the survey area, suggesting that mosquito and mosquito-borne viruses had rich diversity in the area (Liu et al. 2011, Feng et al. 2012, Zuo et al. 2014).

GETV, JEV, YNCxFV, and NDiV were isolated from the whole basin of the Lancang River and Nu River, which reflects the wide distribution of these viruses in this region. Japanese encephalitis is a common and frequently occurring disease in children with high mortality and morbidity rate and mainly distributes in Southeast Asia and China (Pan et al. 2011, Zheng et al. 2012, Gao et al. 2013, Kim et al. 2015). We isolated 29 strains of JEV from 261 mosquito pools, with a high isolation rate (11.11%). Previous studies showed that the isolation rate of JEV was from 4.63% (13/281) to 16.45% (25/152) in southern China from the year of 2005–2013 (Sun et al. 2009a, Liu et al. 2013, Yan et al. 2014), whereas few positive results of JEV isolation were reported in northern China (Li et al. 2010, Cao et al. 2011, Kou et al. 2016). Our results implied a high risk for human infection in the area. It is essential that the JEV vaccination to susceptible population and surveillance of human immune level and mosquito vector should be enhanced. The NDiV belongs to the family Mesoniviridae, order Nidovirales (Zirkel et al. 2013, Vasilakis et al. 2014) and was first reported in a patient from Southeastern Asia, which is potentially pathogenic to human beings (Nga et al. 2011). Our data indicated a wide prevalence along the whole Nu River and Lancang River. Whether the NDiV could infect animals or humans or cause disease requires further biological and seroepidemiological studies in local animal and human populations.

BAV, a member of genus Seadornavirus, family Reoviridae, was recognized as a deterministic pathogen causing fever and viral encephalitis was first isolated from the serum of a patient with fever in 1987 in Yunnan Xishuangbanna Autonomous Prefecture (Xu et al. 1990, Liu et al. 2010, 2016a, 2016b). The present study showed that BAV was distributed widely in the two river basins, which was consistent with previous researches (Gao et al. 2010, Liu et al. 2011). In addition, there were reports that patients infected with BAV may be misdiagnosed as Japanese encephalitis or neglected when JEV and BAV infected simultaneously (Liu et al. 2010). So in the future, etiological detection of BAV should be conducted for patients with unknown fever and viral encephalitis.

In the present research, six mosquito species were found to carry the newly isolated viruses, of which Cx. tritaeniorhynchus was detected to carry the most arbovirus species, followed by An. sinensis. Cx. tritaeniorhynchus and An. sinensis carried most of the 11 virus species other than YNAeFV and AMIV, suggesting that they were main vectors of local mosquito-borne virus, and may play an important role in the virus transmission. In addition, both the mosquito species were collected from cattle pens, hog pens, or hen houses, which are closely related to human activities, and accounted for >90% of all collected mosquitoes. Our findings highlight that mosquito surveillance and control of pathogenic and potential pathogenic arboviruses, such as JEV, BAV, and NDiV should be enhanced in Lancang River and Nu River watersheds in southwestern China.

Several novel or reassortant arboviruses, such as MRV, AMIV, and BAOV, were first found worldwide in the present study. Rhabdoviridae is within a diverse family of nonsegmented, negative-sense single-stranded RNA viruses which can infect a wide range of plants, invertebrates, vertebrates, and humans, and is transmitted by arthropod vectors, such as mosquitoes, ticks, and sandflies (Tesh et al. 1972, Dietzgen et al. 2012). The family includes several fatal pathogens of humans, livestock, and farm products, such as rabies virus, vesicular stomatitis Indiana virus, and Chandipura viruses (Kuzmin et al. 2009, Gurav et al. 2010). BAOV is a Tibet orbivirus-like virus within the genus of Orbivirus in the family Reoviridae (Li et al. 2014, Lei et al. 2015). This genus includes a number of important pathogenic viruses, such as Bluetongue virus and African horse sickness virus (Mertens 1999, Attoui et al. 2011). The whole genetic analysis revealed that BAOV is a reassortant of several Tibet orbivirus strains. Further studies on biological characteristics of these novel arboviruses should be carried out.

In summary, this was the first comprehensive and systematic survey on mosquito-borne arbovirus at the entire watersheds of Lancang River and Nu River in southwestern China. The findings contribute to our understanding of the diversity and wide distribution of mosquito-borne arboviruses, including several confirmed or potential pathogens of human disease. Our findings are also helpful to explore pathogenic evidence for patients with fever and viral encephalitis of unknown etiology.

Footnotes

Acknowledgments

This research was financially supported by the National Natural Science Foundation of China (grant nos. 81273138 and 30660160) and the National Natural Science Foundation's regional science fund (grant no. 81560548).

Authors' Contributions

J.Z. and L.L. conceived and wrote the article. X.G. and Q.Z. performed most of the experiments and collected the mosquito samples. Y.T., H.F., Q.S., and S.X. carried out virus separation identification experiments. H.Z. participated in epidemiological information collection. All authors read and approved the final article.

Author Disclosure Statement

No competing financial interests exist.

References

Attoui

, Mertens

, Becnel

, Belaganahalli

, et al. Family: Reoviridae. In: King

AMQ

, Adams

, Carstens

, Lefkowitz

, eds. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. London: Elsevier/Academic Press, 2012:541–603.

Attoui

, Mohd Jaafar

, Belhouchet

, Aldrovandi

, et al. Yunnan orbivirus, a new orbivirus species isolated from Culex tritaeniorhynchus mosquitoes in China. J Gen Virol, 2005; 86:3409–3417.

Billoir

, Attoui

, Simon

, Gallian

, et al. Molecular diagnosis of group B coltiviruses infections. J Virol Methods, 1999; 81:39–45.

Cao

, Fu

, Tian

, Lu

, et al. Distribution of mosquitoes and mosquito-borne arboviruses in Inner Mongolia, China. Vector Borne Zoonotic Dis, 2011; 11:1577–1581.

Chen

, Liu

, Lv

, Zhang

, et al. A fatal yellow fever virus infection in China: Description and lessons. Emerg Microbes Infect, 2016; 5:e69.

Dietzgen

, Calisher

, Kurath

, Kuzmin

, et al. Family: Rhabdoviridae. In: King

AMQ

, Adams

, Carstens

, Lefkowitz

, eds. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. London: Elsevier/Academic Press, 2011:686–713.

Ejiri

, Kuwata

, Tsuda

, Sasaki

, et al. First isolation and characterization of a mosquito-borne orbivirus belonging to the species Umatilla virus in East Asia. Arch Virol, 2014; 159:2675–2685.

Fan

, Zhao

, Guo

, Sun

, et al. Complete genome sequence of Xishuangbanna flavivirus, a novel mosquito-specific flavivirus from China. Arch Virol, 2016; 161:1723–1727.

Feng

, Fu

, Zhang

, Li

, et al. Distribution of mosquitoes and mosquito-borne viruses along the China-Myanmar border in Yunnan Province. Jpn J Infect Dis, 2012; 65:215–221.

10.

Feng

, Fu

, Zhang

, Petersen

, et al. High incidence of Japanese encephalitis, southern China. Emerg Infect Dis, 2013; 19:672–673.

11.

Feng

, Zhang

, Fu

, Yang

, et al. Investigation on mosquitoes and mosquito-borne viruses in Dehong prefecture, Yunnan province, 2007 and 2010. Chin J Epidemiol, 2014; 35:528–532 (in Chinese).

12.

. Strategy of isolation and identification for Arboviruses. Chin J Vector Biol Control, 2012; 23:432–435 (in Chinese).

13.

, Sun

, Wang

, Cao

, et al. Molecular biological identification of Batai virus isolated in China. Chinese J Exp Clin Virol, 2005; 19:331–334 (in Chinese).

14.

Gao

, Liu

, Wang

, Fu

, et al. Southernmost Asia is the source of Japanese encephalitis virus (genotype 1) diversity from which the viruses disperse and evolve throughout Asia. PLoS Negl Trop Dis, 2013; 7:e2459.

15.

Gao

, Nasci

, Liang

. The neglected arboviral infections in Mainland China. PLoS Negl Trop Dis, 2010; 4:e624.

16.

Gong

, Wu

, Duan

, Feng

, et al. Species richness and vertical distribution pattern of flea fauna in Hengduan Mountains of western Yunnan, China. Biodivers Sci, 2005; 13:279–289.

17.

Guo

, Zhang

, Zhao

, Yan

. The new genetic diagnostic method of epidemic encephalitis B. Chin J Zoonoses, 2001; 17:67–69 (in Chinese).

18.

Gurav

, Tandale

, Jadi

, Gunjikar

, et al. Chandipura virus encephalitis outbreak among children in Nagpur division, Maharashtra, 2007. Indian J Med Res, 2010; 132:395–399.

19.

Huang

, Li

, Zhao

, Pei

, et al. Isolation and characterization of a novel invertebrate iridovirus from adult Anopheles minimus (AMIV) in China. J Invertebr Pathol, 2015; 127:1–5.

20.

Karabatsos

. Supplement to international catalogue of arboviruses including certain other viruses of vertebrates. Am J Trop Med Hyg, 1978; 27:372–440.

21.

Kim

, Cha

, Jeong

, Lee

, et al. Detection of Japanese encephalitis virus genotype V in Culex orientalis and Culex pipiens (Diptera: Culicidae) in Korea. PLoS One, 2015; 10:e0116547.

22.

Kou

, Duan

, Zhang

, Sun

. Status on arbovirus investigation in Xinjiang, China. Chin J Zoonoses, 2016; 32:301–305, 311 (in Chinese).

23.

Kuno

, Chang

, Tsuchiya

, Karabatsos

, et al. Phylogeny of the genus Flavivirus . J Virol, 1998; 72:73–83.

24.

Kuzmin

, Novella

, Dietzgen

, Padhi

, et al. The rhabdoviruses: Biodiversity, phylogenetics, and evolution. Infect Genet Evol, 2009; 9:541–553.

25.

Lei

, Guo

, Fu

, Feng

, et al. Isolation of Tibet orbivirus, TIBOV, from Culicoides Collected in Yunnan, China. PLoS One, 2015; 10:e0136257.

26.

, Zheng

, Zhao

, Fu

, et al. Tibet Orbivirus, a novel Orbivirus species isolated from Anopheles maculatus mosquitoes in Tibet, China. PLoS One, 2014; 9:e88738.

27.

, Shi

, Zheng

, Dai

, et al. Morphologic and molecular characterization of a strain of zika virus imported into Guangdong, China. PLoS One, 2017; 12:e0169256.

28.

, Wang

, Li

, Fu

, et al. Mosquitoes and mosquito-borne arboviruses in the Qinghai-Tibet Plateau—focused on the Qinghai area, China. Am J Trop Med Hyg, 2010; 82:705–711.

29.

Liang

, Gao

, Gould

. Factors responsible for the emergence of arboviruses; strategies, challenges and limitations for their control. Emerg Microbes Infect, 2015; 4:e18.

30.

Liang

, Li

, Zhou

, Fu

, et al. Isolation and complete nucleotide sequence of a Chinese Sindbis-like virus. J Gen Virol, 2000; 81:1347–1351.

31.

Liu

, Gao

, Liang

. Newly recognized mosquito-associated viruses in mainland China, in the last two decades. Virol J, 2011; 8:68.

32.

Liu

, Gao

, Fu

, Li

, et al. Analysis on molecular genetic evolution of Banna virus based on the 12th segment. Chin J Epidemiol, 2016a; 37:1277–1282 (in Chinese).

33.

Liu

, Gao

, Fu

, Li

, et al. Molecular evolution of emerging Banna virus. Infect Genet Evol, 2016b; 45:250–255.

34.

Liu

, Li

, Zhai

, Meng

, et al. Banna virus, China, 1987–2007. Emerg Infect Dis, 2010; 16:514–517.

35.

Liu

, Lu

, Liu

, Jing

, et al. Japanese encephalitis virus in mosquitoes and swine in Yunnan province, China 2009–2010. Vector Borne Zoonotic Dis, 2013; 13:41–49.

36.

, Broker

, Liang

. Tick-borne encephalitis in mainland China. Vector Borne Zoonotic Dis, 2008; 8:713–720.

37.

Mertens

. Orbiviruses and coltiviruses-general features. In: Granoff

, Webster

, eds. Encyclopedia of Virology, 2nd edn. London: Academic Press, 1999:1043–1061.

38.

Nga

, Parquet Mdel

, Lauber

, Parida

, et al. Discovery of the first insect nidovirus, a missing evolutionary link in the emergence of the largest RNA virus genomes. PLoS Pathog, 2011; 7:e1002215.

39.

Obara

, Yamauchi

, Watanabe

, Hasegawa

, et al. Continuity and change of Japanese encephalitis virus in Toyama Prefecture, Japan. Am J Trop Med Hyg, 2011; 84:695–708.

40.

Pan

, Liu

, Wang

, Fu

, et al. Emergence of genotype I of Japanese encephalitis virus as the dominant genotype in Asia. J Virol, 2011; 85:9847–9853.

41.

Pfeffer

, Proebster

, Kinney

, Kaaden

. Genus-specific detection of alphaviruses by a semi-nested reverse transcription-polymerase chain reaction. Am J Trop Med Hyg, 1997; 57:709–718.

42.

Sun

, Zhao

, An

, Guo

, et al. Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China. Arch Virol, 2017; 162:1103–1106.

43.

Sun

, Fu

, Gong

, Ge

, et al. Distribution of arboviruses and mosquitoes in northwestern Yunnan Province, China. Vector Borne Zoonotic Dis, 2009a; 9:623–630.

44.

Sun

, Meng

, Fu

, Feng

, et al. The first report of Kadipiro virus isolation in China. Chin J Virol, 2009b; 25:173–177 (in Chinese).

45.

Tao

, Zhang

, Yang

, Wang

, et al. Investigation of Arboviruses in Lancang river down-stream area in Yunnan province. Chinese J Exp Clin Virol, 2003; 17:322–326 (in Chinese).

46.

Tesh

, Chaniotis

, Johnson

. Vesicular stomatitis virus (Indiana serotype): Transovarial transmission by phlebotomine sandlies. Science, 1972; 175:1477–1479.

47.

Vasilakis

, Guzman

, Firth

, Forrester

, et al. Mesoniviruses are mosquito-specific viruses with extensive geographic distribution and host range. Virol J, 2014; 11:97.

48.

Wang

, Li

, Liang

. Japanese encephalitis in Mainland China. Jpn J Infect Dis, 2009a; 62:331–336.

49.

Wang

, Zhang

, Fu

, Wang

, et al. Isolation of Kyasanur forest disease virus from febrile patient, Yunnan, China. Emerg Infect Dis, 2009b; 15:326–328.

50.

Wang

, Zhang

, Sun

, Fu

, et al. Distribution of mosquitoes and mosquito-borne arboviruses in Yunnan Province near the China-Myanmar-Laos border. Am J Trop Med Hyg, 2011; 84:738–746.

51.

Wang

, Pan

, Zhang

, Fu

, et al. Japanese encephalitis viruses from bats in Yunnan, China. Emerg Infect Dis, 2009c; 15:939–942.

52.

Wang

, Zhou

, Fu

, Zheng

, et al. Yellow fever virus: Increasing imported cases in China. J Infect, 2016; 73:377–380.

53.

Xing

, Guo

, Zhang

, Zhao

, et al. A novel mosquito-borne reassortant orbivirus isolated from Xishuangbanna, China. Virol Sin, 2017; 32:159–162.

54.

, Wang

, Zuo

, Lin

, et al. New orbiviruses isolated from patients with unknown fever and encephalitis in Yunnan province. Chin J Virol, 1990; 6:27–33.

55.

Yan

, Pan

, Zhang

, Zhou

, et al. Study on the genotypic characteristics of Japanese encephalitis virus and serology in the healthy population of Zhejiang province, 2012–2013. Chin J Epidemiol, 2014; 35:1146–1150.

56.

Yin

, Xu

, Su

, Zhu

, et al. Epidemiologic investigation of a family cluster of imported ZIKV cases in Guangdong, China: Probable human-to-human transmission. Emerg Microbes Infect, 2016; 5:e100.

57.

Zhai

, Lv

, Sun

, Fu

, et al. Isolation and characterization of the full coding sequence of a novel densovirus from the mosquito Culex pipiens pallens. J Gen Virol, 2008a; 89:195–199.

58.

Zhai

, Wang

, Sun

, Fu

, et al. Complete sequence characterization of isolates of Getah virus (genus Alphavirus, family Togaviridae) from China. J Gen Virol, 2008b; 89:1446–1456.

59.

Zhang

, Liang

. Arboviruses and arbovirus disease in China. Chin J Vector Biol Control, 2012; 23:377–380.

60.

Zhang

, Shi

, Liu

, Yu

, et al. Isolationg of Chikungunya virus from bat in Yunnan Province and serological investigations. Chin J Virol, 1989; 5:31–36 (in Chinese).

61.

Zhang

, Zhang

, Yang

, Feng

, et al. Mosquitoes of Western Yunnan Province, China: Seasonal abundance, diversity, and arbovirus associations. PLoS One, 2013; 8:e77017.

62.

Zhang

, Guo

, Fan

, Zhao

, et al. Complete genome sequence of Menghai flavivirus, a novel insect-specific flavivirus from China. Arch Virol, 2017; 162:1435–1439.

63.

Zhang

, Zhang

, Gong

, Yang

, et al. Studies on the mosquito communities and the geographical niche of border area in Yunnan Province. Chin J Vector Biol Control, 2001; 12:28–31.

64.

Zheng

, Li

, Wang

, Liang

. Japanese encephalitis and Japanese encephalitis virus in mainland China. Rev Med Virol, 2012; 22:301–322.

65.

Zhou

, Zhang

, Li

, Wang

, et al. Investigation on arboviruses at Sino-Vietnam border areas in Wenshan of Yunnan province. Chin J Prev Med, 2009; 43:1086–1090 (in Chinese).

66.

Zirkel

, Roth

, Kurth

, Drosten

, et al. Identification and characterization of genetically divergent members of the newly established family Mesoniviridae. J Virol, 2013; 87:6346–6358.

67.

Zuo

, Zhao

, Guo

, Zhou

, et al. Detection of Quang Binh virus from mosquitoes in China. Virus Res, 2014; 180:31–38.