Development of a Quantitative RT-PCR Assay to Differentiate Rift Valley Fever Virus Smithburn Vaccine Strain from Clone 13 Vaccine Strain

Abstract

A new quantitative RT-PCR assay was developed to differentiate Rift Valley fever (RVF) Smithburn vaccine strain from Clone 13 vaccine strain. The new qRT-PCR assay targeting the S segment (NSs and N gene) was tested on synthesized standard RNA and MP-12 strain viruses. The detection limit of the new qRT-PCR assay is 1 copy/μL of NSs and N, and is able to differentiate the Smithburn vaccine strain of RVF from the Clone 13 vaccine strain. No cross-reactivity with other vector-borne viruses was observed, a factor that is especially important in the Republic of Korea (ROK). To examine the performance of the qRT-PCR, intra- and inter-assay variability data were analyzed and showed high reproducibility. These results indicate that the new qRT-PCR can be used as a safe and cost-effective test. Furthermore, this result suggests the possibility of differentiation between infected and vaccinated animals diagnostic test in RVF-free countries including ROK.

Introduction

Rift valley fever (RVF) is an important mosquito-borne zoonotic disease. RVF caused by RVF virus, phlebovirus of the Phenuviridae Family. RVF causes high neonatal mortality rates and abortion in pregnant animals, especially sheep, goats, and cattle. In humans, RVF causes a mild to moderate influenza-like syndrome (Gerdes 2004, OIE 2014). However, a small percentage of infections can progress to more severe manifestations such as meningoencephalitis, hemorrhagic disease, and retinitis. RVF outbreaks result in direct and indirect economic losses due to abortions and neonatal mortalities, and control measures instituted, respectively (Geering et al. 2002).

RVF was first reported in Kenya in 1931 (Daubney et al. 1931) and subsequently in many African countries. RVF was first detected outside Africa in the Arabian Peninsula in 2000 (Balkhy and Memish 2003), and, more recently, it was detected in Comores in the French Island of Mayotte in 2007 (Sissoko et al. 2009). With increased international travel and animal trade, the risk of RVF extending to RVF-free areas such as Asia, Europe, and the United States has increased (Kasari et al. 2008, Chevalier 2013, Salman 2013).

Currently, there are no commercially available RVF vaccines for humans, but veterinary vaccines used in endemic countries include the live attenuated RVF virus (RVFV) Smithburn vaccine (Smithburn 1949) and an inactivated vaccine (Meadors et al. 1986). However, due to its potential pathogenicity and adverse effects such as abortion, the use of the Smithburn vaccine has been limited. Recently, a Clone 13 vaccine was developed and is now commercially available from the OBP company in South Africa (Dungu et al. 2010, von Teichman et al. 2011). Other vaccines that could circumvent the shortcomings of the vaccines currently in use, such as the form of DNA subunits, MP-12, different vectors have been formulated but are not yet commercialized (Kortekaas 2014). The most important property of veterinary vaccine development is the ability to differentiate infected from vaccinated animals (DIVA) (Bird and Nichol 2012). DIVA vaccines are important for monitoring and disease eradication, especially in disease-free countries. In addition, the DIVA vaccine should be accompanied by a DIVA diagnostic test.

The diagnostic methods for RVFV detection include virus isolation (Anderson et al. 1989), antigen (Niklasson et al. 1983, Meegan et al. 1989, Fukushi et al. 2012) and antibody detection, and nucleic acid amplification methods. The virus isolation requires labor-intensive cell culture, a procedure that is expensive, time consuming, and requires biosafety level-3 (BSL-3) biocontainment. Various enzyme-linked immunosorbent assays (ELISAs) based on virus antigen or recombinant nucleocapsid proteins of RVFV have been developed and validated for serodiagnosis (Williams et al. 2011, Fafetine et al. 2012, Kim et al. 2012, Jäckel et al. 2013). In addition, antigen-capture ELISAs are also available (Jansen van Vuren and Paweska 2009, Fukushi et al. 2012). However, these methods require several samples and are labor intensive. The virus neutralization test (VNT) is the gold standard serological assay for RVF diagnosis but is laborious, expensive, and takes 5–7 days (Swanepoel et al. 1986). Above all, the VNT uses live virus, necessitating BSL-3 facilities, making it difficult to use in RVF-free countries (OIE 2014). Rapid and sensitive RVFV RNA detection methods have been reported such as conventional RT-PCR (Sall et al. 2002), real-time RT-PCR (Drosten et al. 2002, Bird et al. 2007b, Drolet et al. 2012, Mwaengo et al. 2012), and real-time reverse transcription loop-mediated isothermal amplification (LAMP) tests (Le Roux et al. 2009). However, these tests do not have DIVA capacity. More recently, a quadruplex qRT-PCR, which is DIVA compatible, and a nested qRT-PCR, which can detect low levels of RVFV, were developed (Wilson et al. 2013, Maquart et al. 2014). However, these methods use a standard derived from the virus or more complex and costly and thus difficult to apply in countries that lack appropriate experimental facility, such as developing countries. Therefore, the aim of this study is to develop a safe, cost-effective, and DIVA-compatible qRT-PCR assay that can be used in RVF-free countries, such as the Republic of Korea (ROK).

Materials and Methods

Viruses

The RVF vaccine candidate strain, MP-12, which can be manipulated in a BSL-2 facility, was kindly provided by the United States Department of Agriculture—Agricultural Research Service (USDA-ARS)—Arthropod-Borne Animal Diseases Research Unit. The virus was propagated on Vero cells and titrated by TCID₅₀ (median tissue culture infective dose). It was calculated using the Karber method (Spearman 1908, Kärber 1931). The Akabane virus strain 93FMX (KVCC-VR63; Korea Veterinary Culture Collection), Aino virus strain KSA9901 (KVCC-VR64), Chuzan virus strain YongAm (KVCC-VR66), and Schmallenberg virus (Friedrich Loeffler Institute) were used for testing specificity of the new qRT-PCR assay.

RNA preparation

Viral RNA was prepared from 140 μL of infected Vero cell supernatant using a QIAamp viral RNA kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. The RNA was eluted in 50 μL of elution buffer and stored at −70°C.

Construction of the standard RNA

To evaluate the detection limit of the assay, the targeted regions of the L, M, and S segments were synthesized according to the sequence information of the RVFV Smithburn strain. The L segment (2771–3543), the M segment (658–1314), and the full-length S segment from the Smithburn strain (GenBank acc. no. DQ380157) and the Clone 13 strain (GenBank acc. no. DQ380182) were synthesized (Bioneer, Daejeon, Korea) and used as the PCR template. The PCR product was transcribed in vitro to RNA using a MEGAscript Kit (Life Technologies, Carlsbad, CA). Finally, the in vitro translated RNA was purified after DNAse treatments and quantified with a NanoDrop 2000 spectrophotometer (Thermo Scientific). The number of RNA copies was calculated as previously described (Fronhoffs et al. 2002). The RNA was serially diluted 10-fold from 1 × 10⁶ to 1 × 10⁰ copies/μL with RNase-free water as the diluents and was stored at −20°C before use in standard curve generation. Smithburn strain RNA was used as the standard, whereas Clone 13 strain RNA was used as the differential diagnosis through the same procedure.

Primers and probes design

Two of the primer and probe sets for the S-segment were designed using the PrimerQuest design tools (Integrated DNA Technologies). One detected the NSs gene and the other detected the N gene. The probes were labeled at the 5′ ends with two different reporter dyes (FAM for the NSs gene and Cy5 for the N gene). The primer and probe set are listed in Table 1. Smithburn strain sequence was used as a reference sequence for this design. The L and M segment primers and probes were synthesized based on previous real-time assays (Wilson et al. 2013, OIE 2014).

Table 1.

Primer and Probe Sequences Used for New qRT-PCR for Rift Valley Fever Virus Detection

Primer/probe	Sequence 5′-3′	Probe label	Nucleotide positions	Final concentration (μM)	Tm (°C)
RVF NSs-F	TGTTGGCTTACACAGGATGATAG		511–534	1	53.3
RVF NSs-R	CTGTACGTGAGCAACCTCATAC		592–614	1	51.3
RVF NSs-P	AGAGGGATTGACCTGTGCCTGTTG	5′: FAM, 3′: TAMRA	551–575	0.1	62.2
RVF N-F	ACTCACTCAAGACGACCAAAG		1280–1301	1	50.6
RVF N-R	GGAGGCTCTCATCAACAAGTATAA		1381–1405	1	53.3
RVF N-P	CGGCAGCAACTCGTGATAGAGTCAA	5′: Cy5, 3′: BHQ1	1325–1350	0.1	63.3

RVF, Rift Valley fever.

The new qRT-PCR

Standard RNA was prepared as described in construction of standard RNA and was used as the template. Distilled water was used as negative control. All samples were tested in duplicates. The new qRT-PCR was conducted using the AgPath-ID One-Step RT-PCR Kit (Life Technologies, Inc.) and performed in a 20 μL reaction mixture containing 5 μL of standard RNA, 2 × RT-PCR Buffer, 25 × enzyme mix, 1 μM of each primer (RVF NSs-F, RVF NSs-R, RVF N-F, RVF N-R), 0.1 μM of each probe (RVF NSs-P, RVF N-P), and nuclease-free water to a final volume of 20 μL. Amplification and detection were performed with a CFX96 Touch^™ real-time PCR detection system (Bio-Rad) under the following conditions: 30 min at 45°C, 5 min at 95°C, followed by 45 cycles of 95°C for 5 s and 60°C for 60 s.

The evaluation of the new qRT-PCR

Analytical sensitivity

For the diagnostic sensitivity test, 10-fold serially diluted standard RNA templates between 10⁶ and 10⁰ copies/μL were tested in duplicate to determine detection limit of the new qRT-PCR and to establish the standard curves.

Analytical specificity

For the differential diagnosis, Smithburn standard RNA and Clone 13 RNA were tested in duplicate. Diagnostic specificity was evaluated using other vector-borne viruses listed in Table 2 (Kim et al. 2015b, Lee et al. 2015). These viruses are especially important in the ROK as they have similar clinical signs to RVF.

Table 2.

Vector-Borne Viruses Tested That Are Not Detected by the New qRT-PCR

Virus	Family	Genus	Titer tested (logTCID₅₀/mL)
Akabane	Peribunyaviridae	Orthobunyavirus	4.8
Aino	Peribunyaviridae	Orthobunyavirus	4.4
Chuzan	Peribunyaviridae	Orthobunyavirus	4.5
Schmallenberg	Peribunyaviridae	Orthobunyavirus	4.0

Comparison with standard methods

OIE qRT-PCR (OIE 2014) and a recently published quadruplex qRT-PCR (Wilson et al. 2013) were conducted and compared with the new qRT-PCR assay. The comparison was made by determining the limit of detection using the synthesized standard reference RNA and that of RVFV MP-12. Virus titer was determined to be 10⁸ TCID₅₀/mL and used to prepare 10-fold dilutions.

Reproducibility

To assess the reproducibility of the new qRT-PCR, the serially diluted standard RNA control was tested for inter- and intra-assay variations. All data were analyzed statistically as the means ± standard deviation. The intra-assay variation was evaluated by the means of three rounds of each reaction run, and inter-assay variation was assessed by three independent reactions on different days.

Results

Analytical sensitivity

The detection limit of the new qRT-PCR was 1 copy/μL for NSs and N. The standard curves of NSs and N were established with linear correlations (R ²) of 0.9982 and 0.995, respectively (Fig. 1).

FIG. 1.

Standard curves of the qRT-PCR based on a 10-fold serially diluted RVF standard RNA. (A) NSs gene standard curve and (B) N gene standard curve. RVF, Rift Valley fever.

Analytical specificity

The new qRT-PCR was able to differentiate the Smithburn RNA from the Clone 13 RNA (Fig. 2). In the Smithburn RNA, both NSs and N were detected, whereas only N was detected in the Clone 13 RNA.

FIG. 2.

Diagnostic specificities of the new qRT-PCR for RVFV detection. (A) Smithburn strain and (B) Clone 13 strain synthetic RVF RNA was used in the new qRT-PCR. The diamond symbol line (FAM) and solid line (Cy5) indicates NSs and N gene, respectively. RVFV, RVF virus.

In addition, there was no cross-reaction when the new qRT-PCR was evaluated with other vector-borne viruses (Table 2). This indicates that our method is highly specific for the detection of RVFV.

Comparative efficiency

The performance of the new qRT-PCR was compared with the OIE reference method and quadruplex qRT-PCR with the same 10-fold serial dilution of the standard RNA and the RVFV MP-12 (Table 3). All of the methods detected 10⁰ copies/μL of standard RNA. In the experiment using the RVFV MP-12, the detection limit of all methods was 10⁰ TCID₅₀/mL. The comparison results indicated that the sensitivity of new qRT-PCR is similar to that of other methods.

Table 3.

Comparison of Detection Limits of New qRT-PCR Using Standard RNA and Rift Valley Fever Virus MP-12

		OIE qRT-PCR		New qRT-PCR			Quadruplex qRT-PCR
RNA/virus		M	NSs	N	S	M	L
Standard RNA^a (copies/μL)	10²	33.11	31.29	31.47	31.92	33.00	31.25
	10¹	35.33	34.03	34.62	36.31	35.64	34.65
	10⁰	36.51	36.63	36.37	39.47	39.32	38.89
MP-12 virus (TCID₅₀/mL)	10²	31.37	30.38	31.63	32.39	33.02	34.91
	10¹	34.90	33.79	35.16	34.97	35.55	39.79
	10⁰	35.95	38.27	36.58	36.67	38.07	38.15
Negative control		ND	ND	ND	ND	ND	ND

Synthetic RNA using RVFV Smithburn strain.

ND, not detected; RVFV, Rift Valley fever virus.

Reproducibility

The reproducibility of the new qRT-PCR was analyzed using cycle threshold values in triplicates within each run (intra-assay, Table 4), and also in three different runs (inter-assay, Table 5). The coefficient of variation (CV) of the NSs and N in the intra-assay assessment ranged from 0.11% to 2.47% and from 0.2% to 1.41%, respectively. The CV of the NSs and N for the inter-assay ranged from 0.01% to 0.02% and from 0.00% to 0.02%, respectively.

Table 4.

Reproducibility of the New qRT-PCR in Intra-Assay

Assay	10 ⁶	10 ⁵	10 ⁴	10 ³	10 ²	10 ¹	10 ⁰
Ct for RVFV synthetic RNA standards^a (copy number/μL)
NSs
1	18.47	21.54	24.96	28.08	31.36	34.33	37.50
2	18.60	21.67	24.98	28.13	31.19	33.92	35.69
3	18.38	21.63	25.02	28.16	31.33	33.85	36.70
Ct (means ± SD)	18.48 ± 0.11	21.61 ± 0.07	24.99 ± 0.03	28.12 ± 0.04	31.30 ± 0.09	34.03 ± 0.26	36.63 ± 0.91
CV (%)	0.60	0.31	0.11	0.14	0.29	0.76	2.47
N
1	18.42	21.43	24.94	28.12	31.66	34.37	ND
2	18.42	21.70	25.01	28.16	31.32	35.18	36.30
3	18.34	21.63	25.04	28.26	31.43	34.30	36.44
Ct (means ± SD)	18.39 ± 0.05	21.59 ± 0.15	25.00 ± 0.05	28.18 ± 0.08	31.47 ± 0.17	34.61 ± 0.49	36.37 ± 0.10
CV (%)	0.25	0.67	0.20	0.27	0.55	1.41	0.27

Synthetic RNA using RVFV Smithburn strain.

Ct, cycle threshold; CV, coefficient of variation; SD, standard deviation.

Table 5.

Reproducibility of the New qRT-PCR in Inter-Assay

Assay	10 ⁶	10 ⁵	10 ⁴	10 ³	10 ²	10 ¹	10 ⁰
Ct for RVFV synthetic RNA standards^a (copy number/μL)
NSs
1	18.81	21.99	25.22	28.35	31.45	35.14	38.67
2	17.94	21.14	24.76	28.18	30.72	34.34	37.15
3	18.71	22.10	25.30	28.94	31.50	35.26	38.19
Ct (means ± SD)	18.49 ± 0.39	21.74 ± 0.43	25.09 ± 0.24	28.49 ± 0.33	31.22 ± 0.35	34.91 ± 0.41	38.00 ± 0.63
CV (%)	0.02	0.02	0.01	0.01	0.01	0.01	0.02
N
1	18.62	21.83	25.12	28.30	31.39	36.32	37.73
2	18.03	21.32	24.84	28.40	30.93	34.79	37.61
3	18.37	21.93	25.07	28.71	31.31	35.79	38.03
Ct (means ± SD)	18.34 ± 0.24	21.69 ± 0.27	25.01 ± 0.12	28.47 ± 0.18	31.21 ± 0.20	35.63 ± 0.63	37.79 ± 0.18
CV (%)	0.01	0.01	0.00	0.01	0.01	0.02	0.00

Synthetic RNA using RVFV Smithburn strain.

Discussion

RVF is a vector-borne zoonotic disease that affects animal and human health, and causes economic losses. The geographical distribution of RVF has expanded, and, thus, RVF-free countries are assessing the risk of introduction of the disease (Métras et al. 2011, Chevalier 2013, Rolin et al. 2013, Salman 2013). In these circumstances, recently, the one health control approach has been reported to mitigate an outbreak of RVFV (Hassan et al. 2014, Kortekaas 2014). One health approach is needed for effective early warning, surveillance, and diagnostic capacity. It is important to rapidly and accurately diagnose the disease through continuous surveillance. Therefore, for enhanced diagnostic capacity, European laboratories have evaluated the utility of antibody-based diagnostic assays (Kortekaas et al. 2013), and the European Network for Diagnostics of “Imported” Viral Diseases (ENIVD) has assessed the efficiency and accuracy of RVFV molecular diagnostic methods used by expert laboratories worldwide (Escadafal et al. 2013).

Until now, RVF has not been reported in Asia, including the ROK. However, the possibility of RVFV introduction cannot be ignored because mosquito vectors known to transmit RVFV have previously been identified in the ROK (Seo et al. 2013). Therefore, mosquito vector and serological surveillance was conducted for early detection of RVF in the unfortunate event of introduction in the ROK (Kim et al. 2015a, 2016). In addition, the first nonstop flight between Africa and Northeast Asia by a Korean aircraft started operating in 2012. As a result, increasing intercontinental travel between ROK and Africa may facilitate the introduction of RVFV through several pathways (Kasari et al. 2008). In this situation, we need safe and rapid antigen detection diagnostic methods that could be used in RVF-free countries. The diagnostic tests should ideally be able to discriminate other RVFV from the strain contained in the Clone 13 vaccine that is used in endemic areas in Africa (Dungu et al. 2010, von Teichman et al. 2011).

In the current study, a new qRT-PCR assay that detects the S segments of RVFV, especially the N and NSs genes, was developed. We used the Smithburn strain of RVFV, because RVFV genome is reported to be highly conserved, especially N region (Bird et al. 2007a, Grobbelaar et al. 2011), so it can be used to detect other strains. In addition, it is possible to differentiate between the two vaccine strains as well as other strains. The test utilizes synthesized genes that can be used safely in an RVF country such as ROK. A standard curve was established from 10⁶ to 10⁰ copies/μL and the slope was close to the theoretical slope of −3.3 and the correlation coefficient was close to the R ² of 1 in theory. These values indicate good correlation and suggest good analytical sensitivity. In addition, the CV values of the intra- and inter-assays runs indicated good reproducibility.

The new qRT-PCR assay can be used to rapidly and reliably differentiate Smithburn RNA from Clone 13 RNA. Although we used a synthetic gene not the field virus, the results showed the assay has DIVA potential. The newly developed vaccine, called Clone 13, which can be used safely in pregnant animals, has been used in endemic areas (Dungu et al. 2010, von Teichman et al. 2011). The Clone 13 virus strain has a large deletion (70%) in the NSs gene and is highly attenuated in mice (Vialat et al. 2000). The key feature of using Clone 13 vaccine is the potential to differentiate vaccinated from infected animals, when accompanied by related DIVA diagnostic assays (Bird and Nichol 2012). Recently, a quadruplex qRT-PCR with DIVA potential was developed by Wilson et al. (2013). The test detects all three gene segments. However, it treats live virus for use as a positive control and is more complex because it uses three reporter dyes although it can be modified for two-color systems. In contrast, the new qRT-PCR assay uses noninfectious synthetic genes, requires inexpensive instruments that have two-color channel capabilities, and can be safely used in RVF-free countries at a lower cost.

The new qRT-PCR assay did not have cross-reactivity with other arboviruses. The Akabane virus, Aino virus, and Chuzan virus are very important diseases with clinical signs similar to RVF and with high seropositivity rates in the ROK (Kim et al. 2015b). Schmallenberg virus, an emerging bunyavirus, was first reported in 2011 (Hoffmann et al. 2012) and clinical signs are similar to RVF. Although Schmallenberg virus is not found in ROK, differential diagnosis is meaningful as with other arboviruses (Lee et al. 2015).

A new qRT-PCR for the detection of RVFV has been developed in this study. The assay can differentiate Smithburn RNA from Clone 13 RNA and using the synthetic gene does not require BSL-3 biocontainment. These results show that the new qRT-PCR can be used as a safe and cost-effective test. Furthermore, this result suggests the possibility of DIVA diagnostic test in RVF-free countries including ROK.

Footnotes

Acknowledgments

The authors thank Dr. William C. Wilson and the USDA-ARS for providing the RVFV MP-12 strain. This project was supported financially by a grant from the Animal and Plant Quarantine Agency (APQA), the Ministry of Agriculture, Food and Rural Affairs, BK21 PLUS, Research Institute for Veterinary Science, Seoul National University, Seoul, The Republic of Korea.

Author Disclosure Statement

The authors declare that they have no conflicts of interest.

References

Anderson

Jr. , Saluzzo

, Ksiazek

, Smith

, et al. Comparison of in vitro and in vivo systems for propagation of Rift Valley fever virus from clinical specimens. Res Virol, 1989; 140:129–138.

Balkhy

, Memish

. Rift Valley fever: An uninvited zoonosis in the Arabian Peninsula. Int J Antimicrob Agents, 2003; 21:153–157.

Bird

, Bawiec

, Ksiazek

, Shoemaker

, et al. Highly sensitive and broadly reactive quantitative reverse transcription-PCR assay for high-throughput detection of Rift Valley fever virus. J Clin Microbiol, 2007b; 45:3506–3513.

Bird

, Khristova

, Rollin

, Ksiazek

, et al. Complete genome analysis of 33 ecologically and biologically diverse Rift Valley fever virus strains reveals widespread virus movement and low genetic diversity due to recent common ancestry. J Virol, 2007a; 81:2805–2816.

Bird

, Nichol

. Breaking the chain: Rift Valley fever virus control via livestock vaccination. Curr Opin Virol, 2012; 2:315–323.

Chevalier

. Relevance of Rift Valley fever to public health in the European Union. Clin Microbiol Infect, 2013; 19:705–708.

Daubney

, Hudson

, Garnham

. Enzootic hepatitis or Rift Valley fever. An undescribed virus disease of sheep cattle and man from East Africa. J Pathol, 1931; 34:545–579.

Drolet

, Weingartl

, Jiang

, Neufeld

, et al. Development and evaluation of one-step rRT-PCR and immunohistochemical methods for detection of Rift Valley fever virus in biosafety level 2 diagnostic laboratories. J Virol Methods, 2012; 179:373–382.

Drosten

, Göttig

, Schilling

, Asper

, et al. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol, 2002; 40:2323–2330.

10.

Dungu

, Louw

, Lubisi

, Hunter

, et al. Evaluation of the efficacy and safety of the Rift Valley Fever Clone 13 vaccine in sheep. Vaccine, 2010; 28:4581–4587.

11.

Escadafal

, Paweska

, Grobbelaar

, le Roux

, et al. International external quality assessment of molecular detection of Rift Valley fever virus. PLoS Neg Trop Dis, 2013; 7:e2244.

12.

Fafetine

, Jansen van Vuren

, Paweska

. Comparison of a recombinant nucleocapsid IgG indirect ELISA with an IgG sandwich ELISA for the detection of antibodies to Rift Valley fever virus in small ruminants. Vector Borne Zoonotic Dis, 2012; 12:1062–1064.

13.

Fronhoffs

, Totzke

, Stier

, Wernert

, et al. A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Mol Cell Probes, 2002; 16:99–110.

14.

Fukushi

, Nakauchi

, Mizutani

, Saijo

, et al. Antigen-capture ELISA for the detection of Rift Valley fever virus nucleoprotein using new monoclonal antibodies. J Virol Methods, 2012; 180:68–74.

15.

Geering

, Davies

, Martin

. Preparation of Rift Valley Fever Contingency Plans. FAO Animal Health Manual No. 15. Rome: Food and Agricultural Organization of the United Nations, 2002:72.

16.

Gerdes

. Rift valley fever. Rev Sci Tech, 2004; 23:613–624.

17.

Grobbelaar

, Weyer

, Leman

, Kemp

, et al. Molecular epidemiology of Rift Valley fever virus. Emerg Infect Dis, 2011; 17:2270.

18.

Hassan

, Ahlm

, Evander

. A need for one health approach—Lessons learned from outbreaks of Rift Valley fever in Saudi Arabia and Sudan. Infect Ecol Epidemol, 2014; 4:20710.

19.

Hoffmann

, Scheuch

, Höper

, Jungblut

, et al. Novel orthobunyavirus in cattle, Europe, 2011. Emerg Infect Dis, 2012; 18:469.

20.

Jäckel

, Eiden

, Balkema-Buschmann

, Ziller

, et al. A novel indirect ELISA based on glycoprotein Gn for the detection of IgG antibodies against Rift Valley fever virus in small ruminants. Res Vet Sci, 2013; 95:725–730.

21.

Jansen van Vuren

, Paweska

. Laboratory safe detection of nucleocapsid protein of Rift Valley fever virus in human and animal specimens by a sandwich ELISA. J Virol Methods, 2009; 157:15–24.

22.

Kärber

. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Arch Exptl Pathol Pharmakol, 1931; 162:480–483.

23.

Kasari

, Carr

, Lynn

, Weaver

. Evaluation of pathways for release of Rift Valley fever virus into domestic ruminant livestock, ruminant wildlife, and human populations in the continental United States. J Am Vet Med Assoc, 2008; 232:514–529.

24.

Kim

, Lyoo

, Park

, Choi

, et al. Surveillance of Rift Valley fever virus in mosquito vectors of the Republic of Korea. Vector Borne Zoonotic Dis, 2016; 16:131–135.

25.

Kim

, Nah

, Moon

, Ko

, et al. Competitive ELISA for the detection of antibodies to Rift Valley fever virus in goats and cattle. J Vet Med Sci, 2012; 74:321–327.

26.

Kim

, Park

, Jeoung

, Yeh

, et al. Serological surveillance studies confirm the Rift Valley fever virus free status in South Korea. Trop Anim Health Prod, 2015a; 47:1427–1430.

27.

Kim

, Oem

, Lee

, et al. Seroprevalence of five arboviruses in sentinel cattle as part of nationwide surveillance in South Korea, 2009–2012. J Vet Med Sci, 2015b; 77:247–250.

28.

Kortekaas

. One health approach to Rift Valley fever vaccine development. Antiviral Res, 2014; 106:24–32.

29.

Kortekaas

, Kant

, Vloet

, Cêtre-Sossah

, et al. European ring trial to evaluate ELISAs for the diagnosis of infection with Rift Valley fever virus. J Virol Methods, 2013; 187:177–181.

30.

Le Roux

, Kubo

, Grobbelaar

, van Vuren

, et al. Development and evaluation of a real-time reverse transcription-loop-mediated isothermal amplification assay for rapid detection of Rift Valley fever virus in clinical specimens. J Clin Microbiol, 2009; 47:645–651.

31.

Lee

, Seo

, Park

, Kim

, et al. Detection and differentiation of Schmallenberg, Akabane and Aino viruses by one-step multiplex reverse-transcriptase quantitative PCR assay. BMC Vet Res, 2015; 11:270.

32.

Maquart

, Temmam

, Héraud

, Leparc-Goffart

, et al. Development of real-time RT-PCR for the detection of low concentrations of Rift Valley fever virus. J Virol Methods, 2014; 195:92–99.

33.

Meadors III

, Gibbs

, Peters

. Evaluation of a new Rift Valley fever vaccine: Safety and immunogenicity trials. Vaccine, 1986; 4:179–184.

34.

Meegan

, Le Guenno

, Ksiazek

, Jouan

, et al. Rapid diagnosis of Rift Valley fever: A comparison of methods for the direct detection of viral antigen in human sera. Res Virol, 1989; 140:59–65.

35.

Métras

, Collins

, White

, Alonso

, et al. Rift Valley fever epidemiology, surveillance, and control: What have models contributed?. Vector Borne Zoonotic Dis, 2011; 11:761–771.

36.

Mwaengo

, Lorenzo

, Iglesias

, Warigia

, et al. Detection and identification of Rift Valley fever virus in mosquito vectors by quantitative real-time PCR. Virus Res, 2012; 169:137–143.

37.

Niklasson

, Grandien

, Peters

, Gargan

. Detection of Rift Valley fever virus antigen by enzyme-linked immunosorbent assay. J Clin Microbiol, 1983; 17:1026–1031.

38.

OIE. Rift Valley Fever. In Manual of Diagnostic Tests & Vaccines for Terrestrial Animals, World Organisation for Animal Health (OIE), Paris, France (Chapter 2.1.14). 2014.

39.

Rolin

, Berrang-Ford

, Kulkarni

. The risk of Rift Valley fever virus introduction and establishment in the United States and European Union. Emerg Microbes Infect, 2013; 2:e81.

40.

Sall

, Macondo

, Sene

, Diagne

, et al. Use of reverse transcriptase PCR in early diagnosis of Rift Valley fever. Clin Diagn Lab Immunol, 2002; 9:713–715.

41.

Salman

. Is the United States really at risk for introduction of Rift Valley fever virus?. J Am Vet Med Assoc, 2013; 242:606–608.

42.

Seo

, Kim

, Klein

, Ramey

, et al. Molecular detection and genotyping of Japanese encephalitis virus in mosquitoes during a 2010 outbreak in the Republic of Korea. PloS One, 2013; 8:e55165.

43.

Sissoko

, Giry

, Gabrie

, Tarantola

, et al. Rift valley fever, Mayotte, 2007–2008. Emerg Infect Dis, 2009; 15:568.

44.

Smithburn

. Rift Valley fever: The neurotropic adaptation of the virus and the experimental use of this modified virus as a vaccine. Br J Exp Pathol, 1949; 30:1.

45.

Spearman

. The method of “right and wrong cases” (“constant stimuli”) without Gauss's formulae. Br J Psychol, 1908; 2:227–242.

46.

Swanepoel

, Struthers

, Erasmus

, Shepherd

, et al. Comparative pathogenicity and antigenic cross-reactivity of Rift Valley fever and other African phleboviruses in sheep. Epidemiol Infect, 1986; 97:331–346.

47.

Vialat

, Billecocq

, Kohl

, Bouloy

. The S segment of rift valley fever phlebovirus (Bunyaviridae) carries determinants for attenuation and virulence in mice. J Virol, 2000; 74:1538–1543.

48.

von Teichman

, Engelbrecht

, Zulu

, Dungu

, et al. Safety and efficacy of Rift Valley fever Smithburn and Clone 13 vaccines in calves. Vaccine, 2011; 29:5771–5777.

49.

Williams

, Ellis

, Smith

, Potgieter

, et al. Validation of an IgM antibody capture ELISA based on a recombinant nucleoprotein for identification of domestic ruminants infected with Rift Valley fever virus. J Virol Methods, 2011; 177:140–146.

50.

Wilson

, Romito

, Jasperson

, Weingartl

, et al. Development of a Rift Valley fever real-time RT-PCR assay that can detect all three genome segments. J Virol Methods, 2013; 193:426–431.