Occurrence and Genotyping of Coxiella burnetii in Hedgehogs in China

Abstract

Coxiella burnetii is the causative agent of query fever (Q fever), and distributes broadly in environment. Livestock are identified as main reservoirs, which may infect people through their contaminative urine, feces, milk, and birth products. Wild animals can also be the potential carriers and transmitters of C. burnetii. To understand the geographic distribution and host species of C. burnetii in China, we investigated the prevalence of C. burnetii in hedgehogs (Erinaceus amurensis) in Hubei Province. Hedgehogs were tested for C. burnetii with PCR targeting three genes (com1, rrs, and icd) followed by multispacer sequence typing (MST). We found that 12.2% (5/41) hedgehogs were PCR positive for C. burnetii. MST revealed presence of two novel genotypes and phylogenetic analysis revealed that the strains were similar to a group of isolates from chronic Q fever patients and mammals. This study showed that C. burnetii are highly prevalent in hedgehogs in Hubei Province in central China, suggesting that hedgehogs may play an important role in the ecology and transmission of C. burnetii to humans because it is captured and used as traditional medicine in China.

Introduction

Q fever (query fever) is a zoonotic disease caused by Coxiella burnetii, an obligate intracellular Gram-negative bacterium, which survives and thrives in phagolysosome of host cells (Voth and Heinzen 2010). C. burnetii is a species in the family Coxiellaceae of order Legionellales. The genus Coxiella is morphologically similar to Rickettsia, but with a variety of genetic and physiological differences. C. burnetii can infect people and cause acute or chronic infection (Marrie and Raoult 2002). Most acute infections are asymptomatic or present nonspecific clinical symptoms similar to pneumonia and influenza. In chronic infection, endocarditis and chronic hepatitis are common features and may lead to death (Fournier et al. 1998). C. burnetii infects a variety of animals, including mammals, birds, and arthropods (Geddes 1983). Although most animals infected by C. burnetii present no significant symptoms, they may suffer abortion, stillbirths, mastitis, or infertility. Animals chronically infected with C. burnetii persistently shed it into environment through feces, urine, and milk (Rodolakis et al. 2007).

Previous studies indicated that C. burnetii is widely spread in environment, primarily in water and air, and ingestion of contaminative milk and inhalation of contaminative aerosol are probably the main mode of transmission (Fishbein and Raoult 1992). Livestock, especially cattle, goats, and sheep, are commonly identified as reservoirs, which may transmit C. burnetii to people through contaminated urine, feces, milk, and birth products (Berri et al. 2000, Guatteo et al. 2007). On the other hand, arthropod-borne and person-to-person transmission are rare (Raoult and Stein 1994, Beaman and Hung 2010). Hedgehogs are known to be a common or potential reservoir of numerous pathogens (Silaghi et al. 2012, Sangster et al. 2016). There were reports about detection of C. burnetii in ectoparasites from hedgehogs, but no report about detection of C. burnetii in hedgehogs (Leulmi et al. 2016, Bolaños-Rivero et al. 2017).

Multispacer sequence typing (MST) is a genotyping method based on intergenic regions, which are potentially variable (Enright and Spratt 1999). The researchers who described C. burnetii MST in 2005 selected 10 spacers that exhibited the most variation among 68 spacers and yielded 30 different genotypes (Glazunova et al. 2005). Since then, many studies have used this technique to identify C. burnetii genotypes around the world (Rahal et al. 2013; Kumsa et al. 2015). According to the method, some genotypes have regional restriction and host specificity.

C. burnetii has a wide distribution, including America, Europe, Asia, Africa, and Oceania (IRONS et al. 1947, Spelman 1982, Yarrow et al. 1990, Dupont et al. 1992). In China, since the first report of Q fever in the 1950s, there were a few investigations of C. burnetii infections in people and domesticated animals. Cattle, goats, dogs, pigs, mice, and ticks had high prevalence of C. burnetii by indirect immunofluorescence assay (IFA), enzyme-linked immunosorbent assay (ELISA), and PCR tests (El-Mahallawy et al. 2015). However, most of studies focused on serological evidence, and molecular evidence was deficient. In addition, these researches only cover domesticated animals in a few provinces, mainly in north China, but the prevalence C. burnetii in other provinces and in wild animals is unknown in China. The aim of this study is to investigate the prevalence and genetic diversity of C. burnetii in wild hedgehogs from Hubei Province in central China.

Materials and Methods

Sample collection

In May and October 2018, hedgehogs were captured in the forest sites near cesspools with meat bait from Xianning and Wuhan cities, Hubei Province, and identified through morphological observation after being anesthetized by injection of chloral hydrate (Corbet 2010). The hedgehogs were euthanized with chloral hydrate to collect hearts, livers, spleens, kidneys, and lungs and the specimens were stored at −80°C.

DNA extraction and PCR amplification

Total DNA was extracted from spleen tissues using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's introduction. Nested PCR was used to amplify the highly conservative region of outer membrane protein gene (com1). On the basis of com1 amplification results, positive samples were further amplified with 16S rRNA gene (rrs) and isocitrate dehydrogenase gene (icd) primers by PCR. All the primers are listed in Table 1. In each set of PCR, nuclease-free water was used as a negative control. All PCR reactions were performed under the following conditions: 1 denaturing cycle for 5 min at 95°C followed by 35 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 55°C, extension for 90 s (first round) or 1 min (second round) at 72°C, and an additional final extension for 10 min at 72°C.

Table 1.

PCR Primers Used for Amplification of Coxiella burnetii Genes and Gene Spacers

Primers	Sequences (5′→3′)	Product length (bp)	Target genes or spacers	References
CBcom1F1	AGTAGAAGCATCCCAAGCATTG	438	com1	Liu et al. (2013)
CBcom1R1	TGCCTGCTAGCTGTAACGATTG
CBcom1F2	GAAGCGCAACAAGAAGAACA
CBcom1R2	TGGAAGTTATCACGCAGTTG
CB16SF	ATTGAAGAGTTTGATTCTGG	1450	rrs	Chitanga et al. (2018)
CB16SR	CGGCCTCCCGAAGGTTAG	1450	rrs	Chitanga et al. (2018)
CBicdF	CGGAGTTAACCGGAGTATCCA	738	icd
CBicdR	CCGTGAATTTCATGATGTTACCTTT	738	icd
COX2F	CAACCCTGAATACCCAAGGA	397	COX2	Glazunova et al. (2005)
COX2R	GAAGCTTCTGATAGGCGGGA			Glazunova et al. (2005)
COX5F	CAGGAGCAAGCTTGAATGCG	395	COX5
COX5R	TGGTATGACAACCCGTCATG
COX18F	CGCAGACGAATTAGCCAATC	557	COX18
COX18R	TTCGATGATCCGATGGCCTT
COX20F	GATATTTATCAGCGTCAAAGCAA	631	COX20
COX20R	TCTATTATTGCAATGCAAGTGG
COX22F	GGGAATAAGAGAGTTAGCTCA	383	COX22
COX22R	CGCAAATTTCGGCACAGACC
COX37F	GGCTTGTCTGGTGTAACTGT	463	COX37
COX37R	ATTCCGGGACCTTCGTTAAC
COX51F	TAACGCCCGAGAGCTCAGAA	674	COX51
COX51R	GCGAGAACCGAATTGCTATC
COX56F	CCAAGCTCTCTGTGCCCAAT	479	COX56
COX56R	ATGCGCCAGAAACGCATAGG
COX57F	TGGAAATGGAAGGCGGATTC	617	COX57
COX57R	GGTGGAAGGCGTAAGCCTTT
COX61F	GAAGATAGAGCGGCAAGGAT	611	COX61
COX61R	GGGATTTCAACTTCCGATAGA

PCR products were analyzed with 1.2% agarose gel electrophoresis and detected with ethidium bromide under UV light. PCR products with expected sizes were excised from gels and extracted with a Gel Extraction Kit (TSINGKE, Beijing, China), and were cloned into the pMD19-T vector (TaKaRa, Kusatsu, Japan). The recombinant plasmids were sequenced on both strands.

Genotyping of C. burnetii detected in hedgehogs

MST was used to determine the genotypes of C. burnetii in hedgehogs. The 10 gene spacer regions, including cox2, cox5, cox18, cox20, cox22, cox37, cox51, cox56, cox57, and cox61, were amplified by PCR and sequenced to genotype C. burnetii in hedgehogs as previously described (Glazunova et al. 2005). PCR primers are listed in Table 1. The genotypes identified by MST were compared with existing genotypes in the C. burnetii MST database (http://ifr48.timone.univ-mrs.fr/mst/coxiella_burnetii/groups.html) and defined sequence types (STs) by using allele profiles.

Phylogenetic analysis

Sequence chromatograms were examined with Chromas 2.5.1 (Technelysium, Tewantin, Australia) and sequences were analyzed by Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Phylogenetic trees were constructed with the maximum likelihood method of MEGA 7.0 software.

Ethical approval

This study was approved by the Ethics Committee of Wuhan University (2018010). Hedgehogs were handled in accordance with good animal practices required by the Animal Ethics Procedures and Guidelines of the People's Republic of China.

Results

Hedgehog collection

A total of 41 hedgehogs were collected from Xianning and Wuhan cites, Hubei Province of China, in which 22 were captured in May and 19 were captured in October. All hedgehogs were identified through morphological observation as Erinaceus amurensis.

Detection of C. burnetii in hedgehogs by PCR

In this study, we screened C. burnetii by PCR in the spleens of hedgehogs. We found that 5 out of 41 (12.2%) spleen samples were positive to C. burnetii with com1 gene. On the basis of com1 amplification results, two (4.9%) spleen samples were positive to C. burnetii with rrs and icd gene. Sequences obtained in this study were deposited in GenBank with the following accession numbers: MK388244–MK388248 (com1), MN267693–MN267694 (rrs), and MN263245–MN263246 (icd).

Multispacer sequence genotyping of C. burnetii

We used hedgehog spleen DNA rather than DNA from isolates to type C. burnetii; the results were arduous to obtain. Only the two samples that were positive for both rrs and icd were successfully amplified for all the 10 spacers (cox2, cox5, cox18, cox20, cox22, cox37, cox51, cox56, cox57, and cox61), and other samples failed to be amplified for any sequence of each spacer. The comparison results showed the presence of two novel STs: NEW1 and NEW2 (Table 2). Phylogenetic analysis revealed that the two novel STs clustered in the same branch and close to MST1 (Fig. 1).

FIG. 1.

Maximum likelihood phylogenetic tree of Coxiella burnetii genotypes identified with MST. The tree was constructed by using the Kimura 2-parameter model with MEGA 7.0 (www.megasoftware.net). Bootstrap values were performed with 1000 replicates. Bootstrap values ≥50% are shown at branch nodes. The novel STs detected in this study were marked with circles. MST, multispacer sequence typing; ST, sequence type.

Table 2.

Multispacer Sequence Types Found in Hedgehogs in China

Sample ID	Selected spacers										MST groups
Sample ID	COX2	COX5	COX18	COX20	COX22	COX37	COX51	COX56	COX57	COX61	MST groups
B10	New	New	New	20.5	New	37.5	New	New	New	61.6	New1
C7	2.8	New	New	20.5	22.6	37.5	51.8	New	57.5	New	New2

MST, multispacer sequence typing.

Sequencing and phylogenetic analysis

BLAST analysis showed that the partial sequences of com1, rrs, and icd genes of C. burnetii were highly homologous among the hedgehogs with 99.1–100% homology. The phylogenetic trees based on sequence icd were conducted and showed that these isolated separated into three main groups (Fig. 2). Group I contained isolates from chronic human Q fever patients, livestock, and ticks. Group II contained isolates from acute human Q fever patients and mammals. Group III included isolates from chronic Q fever patients in Canada and the United States. The sequences detected in this study belonged to group II.

FIG. 2.

Maximum likelihood phylogenetic tree of Coxiella burnetii based on the sequence of icd. The tree was constructed by using the Kimura 2-parameter model with MEGA 7.0 (www.megasoftware.net). Bootstrap values were performed with 1000 replicates. Bootstrap values ≥50% are shown at branch nodes. The GenBank accession number and the origin country of each C. burnetii were labeled on each line. The sequences detected in this study were marked with circles. Scale bar indicates nucleotide substitution per site.

Discussion

C. burnetii is a common pathogen that distributes in almost every country, and it may be the result of its resistance to many environment factors such as high temperature and ultraviolet light (Angelakis and Raoult 2010). Since the first description of Q fever in Australia in 1937 (Derrick 1983), knowledge about C. burnetii has increased dramatically. However, the prevalence of C. burnetii is usually underestimated because the infection often causes nonpathognomonic signs and there are few convenient diagnostic tools. Therefore, misdiagnosis occurs frequently. Humans are susceptible to C. burnetii, and infection in humans may cause acute or chronic Q fever ranging from asymptomatic to fatal disease (Georgiev et al. 2013). From 2007 to 2010, a large outbreak of Q fever in Netherlands indicated that the disease might become a severe public health problem (Delsing et al. 2010).

The epidemiological features of C. burnetii vary among the geographic areas, including situations of endemics and occurrence of large outbreaks (Eldin et al. 2017). Currently, serology methods, including immunofluorescence assay and enzyme-linked immunosorbent assay, are most commonly used for diagnosis of C. burnetii, and detection of DNA by PCR is often used in research. The infection rates of C. burnetii in wild and domesticated animals around the world varied in different places. With molecular detection, the infection rate of C. burnetii was 16.7% in red foxes in Thailand (Sumrandee et al. 2016), 45.0% in rodents and 10.0% in dogs in Zambia (Chitanga et al. 2018), 48.0% in cattle and 23.0% in goats in Turkey (Can et al. 2015), and 0.3% in pigs in South Korea (Seo et al. 2016). The seroprevalence was even higher than PCR-positive rate, ranging from 6% to 60%. In China, there were several molecular investigations about C. burnetii. The prevalence of C. burnetii in goats from Xinjiang Province and Beijing City had been reported as 25% and 5%, respectively (Pan et al. 2013). The prevalence of C. burnetii in ticks from four provinces in Northwestern China had been reported as 10% overall (Zhang and Liu 2011). In this study, the prevalence of C. burnetii in hedgehogs was 12.2% (5/41). The phylogenetic trees indicated that the C. burnetii detected in this study belonged to “chronic” group II.

MST is an effective method to determine C. burnetii genotypes. This method is discriminant and convenient without the need for enrichment by a culture step. Until now, there have been 65 STs of C. burnetii identified by MST in humans and animals all over the world (Angelakis et al. 2013). In this study, we detected the presence of two novel STs in hedgehogs from central China. Both samples were consistent with previous STs in several spacers and showed diversity in the other spacers. The disparity may result from the difference of region and host.

In traditional Chinese medicine, hedgehogs are considered tonic and used in treatments for hemorrhoids. Hedgehogs are frequently captured from wild and eaten across central China. People may be infected with C. burnetii when contacting with hedgehogs such as inhaling the contaminative aerosol in the process of capturing or slaughtering. Previous studies have demonstrated that hedgehogs can serve as animal hosts for pathogenic Leptospira and severe fever with thrombocytopenia syndrome virus (SFTSV) in China (Sun et al. 2017, Ma et al. 2020). Therefore, increased awareness and protective measures are needed to prevent infection of pathogenic bacteria and viruses from hedgehogs in China.

Conclusion

We identified two novel genotypes of C. burnetii and demonstrated high prevalence of C. burnetii in hedgehogs from central China, suggesting that hedgehogs might be important in the transmission of C. burnetii.

Footnotes

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by a grant from National Natural Science Funds of China (grant nos. 31570167 and 81971939).

References

Angelakis

, Million

, D'Amato

, Rouli

, et al. Q fever and pregnancy: Disease, prevention, and strain specificity. Eur J Clin Microbiol Infect Dis, 2013; 32:361–368.

Angelakis

, Raoult

. Q fever. Vet Microbiol, 2010; 140:297–309.

Beaman

, Hung

. Pericarditis associated with tick-borne Q fever. Aust N Z J Med, 2010; 19:254–256.

Berri

, Laroucau

, Rodolakis

. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol, 2000; 72:285–293.

Bolaños-Rivero

, Carranza-Rodríguez

, Rodríguez

, Gutiérrez

, et al. Detection of Coxiella burnetii DNA in peridomestic and wild animals and ticks in an endemic region (Canary Islands, Spain). Vector Borne Zoonotic Dis, 2017; 17:630–634.

Can

, Elmalı M, Karagöz A. Detection of Coxiella burnetii in cows', goats', and ewes' bulk milk samples using polymerase chain reaction (PCR). Mljekarstvo, 2015; 65:26–31.

Chitanga

, Simulundu

, Simuunza

, Changula

, et al. First molecular detection and genetic characterization of Coxiella burnetii in Zambian dogs and rodents. Parasit Vectors, 2018; 11:40.

Corbet

. The family Erinaceidae: A synthesis of its taxonomy, phylogeny, ecology and zoogeography. Mamm Rev, 2010; 18:117–172.

Delsing

, Kullberg

, Bleeker-Rovers

. Q fever in the Netherlands from 2007 to 2010. Neth J Med, 2010; 68:382–387.

10.

Derrick

. “Q” fever, a new fever entity: Clinical features, diagnosis and laboratory investigation. Med J Aust, 1983; 5:790–800.

11.

Dupont

, Raoult

, Brouqui

, Janbon

, et al. Epidemiologic features and clinical presentation of acute Q fever in hospitalized patients: 323 French cases. Am J Med, 1992; 93:427–434.

12.

Eldin

, Mélenotte

, Mediannikov

, Ghigo

, et al. From Q fever to Coxiella burnetii infection: A paradigm change. Clin Microbiol Rev, 2017; 30:115.

13.

El-Mahallawy

, Lu

, Kelly

, Xu

, et al. Q fever in China: A systematic review, 1989–2013. Epidemiol Infect, 2015; 143:673–681.

14.

Enright

, Spratt

. Multilocus sequence typing. Trends Microbiol, 1999; 7:482–487.

15.

Fishbein

, Raoult

. A cluster of Coxiella burnetii infections associated with exposure to vaccinated goats and their unpasteurized dairy products. Am J Trop Med Hyg, 1992; 47:35–40.

16.

Fournier

, Casalta

, Piquet

, Tournigand

, et al. Coxiella burnetii infection of aneurysms or vascular grafts: Report of seven cases and review. Clin Infect Dis, 1998; 26:116–121.

17.

Geddes

. Q fever. Br Med J, 1983; 287:927–928.

18.

Georgiev

, Afonso

, Neubauer

, Needham

, et al. Q fever in humans and farm animals in four European countries, 1982 to 2010. Eurosurveillance, 2013; 18:15–32.

19.

Glazunova

, Roux

, Freylikman

, Sekeyova

, et al. Coxiella burnetii genotyping. Emerg Infect Dis, 2005; 11:1211–1217.

20.

Guatteo

, Beaudeau

, Joly

, Seegers

. Coxiella burnetii shedding by dairy cows. Vet Res, 2007; 38:849–860.

21.

Irons

, Murphy

, Wolfe

. Q fever in the United States. III—Serologie observations in an outbreak among stock handlers and slaughterhouse workers. J Am Med Assoc, 1947; 133:819.

22.

Kumsa

, Socolovschi

, Almeras

, Raoult

, et al. Occurrence and genotyping of Coxiella burnetii in ixodid ticks in Oromia, Ethiopia. Am J Trop Med Hyg, 2015; 93:1074–1081.

23.

Leulmi

, Aouadi

, Bitam

, Bessas

, et al. Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria. Parasit Vectors, 2016; 9:1–8.

24.

Liu

, Xu

, Fu

, Li

, et al. Coxiella burnetii in rodents on Heixiazi Island at the Sino-Russian border. Am J Trop Med Hyg, 2013; 88:770–773.

25.

, Gong

, Xiao

, Liu

, et al. Detection of Leptospira interrogans in hedgehogs from Central China. Vector Borne Zoonotic Dis, 2020. [Epub ahead of print]; DOI: 10.1089/vbz.2019.2544.

26.

Marrie

, Raoult

. Update on Q fever, including Q fever endocarditis. Curr Clin Top Infect Dis, 2002; 22:97.

27.

Pan

, Zhang

, Fan

, Zhang

, et al. Rapid, simple and sensitive detection of Q fever by loop-mediated isothermal amplification of the htpAB gene. PLoS Negl Trop Dis, 2013; 7:117–120.

28.

Rahal

, Tahir

, Eldin

, Bitam

, et al. Genotyping of Coxiella burnetii detected in placental tissues from aborted dairy cattle in the north of Algeria. Comp Immunol Microbiol Infect Dis, 2013; 57:50–54.

29.

Raoult

, Stein

. Q fever during pregnancy—a risk for women, fetuses, and obstetricians. N Engl J Med, 1994; 330:371.

30.

Rodolakis

, Berri

, Héchard

, Caudron

, et al. Comparison of Coxiella burnetii shedding in milk of dairy bovine, caprine, and ovine herds. J Dairy Sci, 2007; 90:5352–5360.

31.

Sangster

, Blake

, Robinson

, Hopkins

, et al. Detection and molecular characterization of Cryptosporidium parvum in British European hedgehogs (Erinaceus europaeus). Vet Parasitol, 2016; 217:39–44.

32.

Seo

, Ouh

, Lee

, Kwak

. Detection and genotyping of Coxiella burnetii in pigs, South Korea, 2014–2015. Emerg Infect Dis, 2016; 22:2192–2195.

33.

Silaghi

, Skuballa

, Thiel

, Pfister

, et al. The European hedgehog (Erinaceus europaeus)—a suitable reservoir for variants of Anaplasma phagocytophilum?. Ticks Tick Borne Dis, 2012; 3:49–54.

34.

Spelman

. Q fever: A study of 111 consecutive cases. Med J Aust, 1982; 1:547.

35.

Sumrandee

, Baimai

, Trinachartvanit

, Ahantarig

. Molecular detection of Rickettsia, Anaplasma, Coxiella and Francisella bacteria in ticks collected from Artiodactyla in Thailand. Ticks Tick Borne Dis, 2016; 7:678–689.

36.

Sun

, Liu

, Luo

, Zhao

, et al. Seroprevalence of severe fever with Thrombocytopenia syndrome virus in hedgehog from China. Vector Borne Zoonotic Dis, 2017; 17:347–350.

37.

Voth

, Heinzen

. Lounging in a lysosome: The intracellular lifestyle of Coxiella burnetii . Cell Microbiol, 2010; 9:829–840.

38.

Yarrow

, Slater

, Costin

. Q fever in Israel. Public Health Rev, 1990; 18:129.

39.

Zhang

, Liu

. Molecular epidemiological studies on Coxiella burnetii from Northwestern China. J Pathog Biol, 2011; 6:183–185 [in Chinese].