Tetrahydroxystilbene Glucoside Attenuates Oxidative Stress-Induced Aging by Regulating Oxidation Resistance and Inflammation in Larval Zebrafish

Abstract

Population aging is a global problem worldwide, and the discovery of antiaging drugs and knowledge of their potential molecular mechanisms are research hotspots in biomedical field. Tetrahydroxystilbene glucoside (TSG) is a natural component isolated from Heshouwu (Polygonum multiflorum Thunb.). It has been widely used to treat various chronic diseases for its remarkable biological activities. In this study, we successfully established aging larval zebrafish by exposing larvae to 2 mM hydrogen peroxide (H₂O₂). Using this aging model, we assessed the antiaging effect of TSG with different concentrations (25–100 μg/mL). After being treated with H₂O₂, zebrafish showed the obvious aging-associated phenotypes characterized by higher senescence-associated β-galactosidase activity, significantly downregulated expression of sirtuin 1 (sirt1) and telomerase reverse transcriptase (tert), and upregulated serpine1 mRNA level compared to the control group. TSG pretreatment delayed the aging process of oxidative stress-induced zebrafish, indicative of the reduced positive rate of senescence-associated β-galactosidase, improved swimming velocity, and stimulus-response capacity. Further studies proved that TSG could suppress reactive oxygen species production and enhance the activity of antioxidant enzymes superoxide dismutase and catalase. TSG also inhibited the H₂O₂-induced expressions of inflammation-related genes il-1β, il-6, cxcl-c1c, and il-8 in aging zebrafish, but it did not affect apoptosis-related genes (bcl-2, bax, and caspase-3) of aging zebrafish. In conclusion, TSG can protect against aging by regulating the antioxidative genes and enzyme activity, as well as inflammation in larval zebrafish, providing insight into the application of TSG for clinical treatment of aging or aging-related diseases.

Introduction

With the aging population growing at an unprecedented rate worldwide, aging is the 21st century's dominant demographic phenomenon.¹ Aging is characterized by a progressive loss of physiological integrity, leading to decreased bodily functions and an increased death rate. Meanwhile, aging is a predominant risk factor for most aging-related diseases, such as cancers, cardiovascular disorders, and neurodegenerative diseases.² In recent years, aging research has experienced unprecedented advances that promote an understanding of aging mechanisms.

Studies show that the aging process can be slowed down to a certain extent by intervening in cellular senescence,³ internal environment,⁴ gut microbiota,^5,6 and caloric restriction,⁷ which will alleviate the functional decline of aging-related diseases. Although evidence has revealed the potential molecular mechanisms that trigger aging, there is still no fully effective drug for preventing aging due to its complex process. Hence, how to delay aging and the screening of antiaging medicines have been a research hotspot in the biomedical field.

Zebrafish shares high homology with the human genome and has emerged as a model system for vertebrate aging research.⁸ The telomere length of zebrafish is similar to that of human beings, and they have the same aging process as human beings, but their life span is relatively short.^9,10 Like humans, zebrafish are subject to gradual aging, which displays similar senescence-associated symptoms, including high β-galactosidase activity, increased oxidized protein levels, severe spinal curvatures, impaired locomotor activity, and declined cognitive functions.^11–13 Therefore, zebrafish is an ideal aging model for large-scale, high-throughput pharmacological and genetic screening.

Polygonum multiflorum Thunb., called Heshouwu in China, is a traditional Chinese herbal medicine and exhibits curative activities in treating various diseases,^14,15 such as cancer,¹⁶ dyslipidemia,¹⁷ and aging-related diseases.^18,19 Stilbene glycoside (2, 3, 5, 4′-tetrahydroxystilbence-2-O-β-D-glucoside, TSG) is a natural component extracted from Polygonum multiflorum Thunb. TSG is the main quality control standard of Polygonum multiflorum Thunb in the Chinese pharmacopoeia.²⁰ Modern pharmacological researches show that TSG has various biological activities, including anti-inflammation, antioxidation, neuroprotection, and antiaging.^21,22

Based on previous studies, accumulation of reactive oxygen species (ROS) can lead to oxidative stress and consequent damage to cellular membranes and functions, thus leading to cellular senescence.^23,24 Hence, TSG may be conducive to delaying the oxidative stress-induced aging process. However, there are limited investigations to clarify the underlying pharmacological mechanisms of TSG against aging. This study established an oxidative stress-induced aging zebrafish model by treating larvae with hydrogen peroxide (H₂O₂). Using this model, we explored the antiaging effect and potential mechanism of TSG.

Materials and Methods

Materials

2,3,5,4′-Tetrahydroxystilbence-2-O-β-D-glucopyranoside (TSG) (purity >98%) was purchased from Aladdin reagent, Inc. (Shanghai, China). A H₂O₂ (30 wt.%) solution was purchased from Sinopharm Chemical Reagent Co., Ltd. (Beijing, China). Senescence-associated β-galactosidase (SA-β-Gal) Staining Kit was purchased from Cell Signaling Technology, Inc. (Beverly, MA). ROS Assay Kit, Total Superoxide Dismutase (SOD) Assay Kit, Catalase (CAT) Assay Kit, and Lipid Peroxidation malondialdehyde (MDA) Assay Kit were obtained from Beyotime Biotechnology (Shanghai, China). Trizol reagent, cDNA synthesis kit, and SYBR QPCR Mixture were purchased from ALLMEEK Technology Co., Ltd (Beijing, China).

Zebrafish feeding and TSG treatment

The wild-type AB strain zebrafish used in this study were raised in recirculation systems at 28.5°C under an alternative 14-h light/10-h dark cycle. H₂O₂ and TSG reagents were directly dissolved into egg water. Larval zebrafish were randomly divided into five groups (n = 100 per group) at 72 h postfertilization (hpf) and cultured in the 90 mm cell culture dish. The specific operations of each group are as follows: control group, treated with egg water; H₂O₂ group, treated with H₂O₂ (2 mM) in embryo water; TSG-L group, treated with H₂O₂ plus low concentration of TSG (25 μg/mL); TSG-M group, treated with H₂O₂ and middle concentration of TSG (50 μg/mL); and TSG-H group, treated with H₂O₂ and high concentration of TSG (100 μg/mL).

Varying concentrations of TSG (25–100 μg/mL) was dissolved into egg water and pretreated larvae for 24 h. Then, 96 hpf larvae were incubated with egg water containing 2 mM H₂O₂ for 4 h, as referred by a previous report.²⁵ During the experiment, a complete water change was carried out every 24 h to ensure water quality. The flow diagram of the experimental protocol is shown in Figure 1. All animal experiments were approved by the animal ethics committee of Hubei University of Chinese Medicine and conducted following the Guiding Principles for the Care and Use of Laboratory Animals.

FIG. 1.

Outline of experimental design used in this study. hpf, hours postfertilization.

SA-β-gal staining

According to the manufacturer's instructions (Cell Signaling Technology, Inc., MA), SA-β-gal activity was detected in larval zebrafish. Briefly, larval zebrafish were fixed in a fixative solution at 4°C overnight and then rinsed three times for 15 min in phosphate-buffered saline (PBS) (pH = 7.4), followed by washing in PBS (pH 6.0) for another 1 h at 4°C. After that, 1 mL of staining solution was added, and the samples were incubated overnight at 37°C in a dry incubator (without CO₂). Images were taken using a dissecting microscope with an MSX1 Microscope camera (Mshot, China). Qualitative analysis was done by a selection tool in Adobe Photoshop for the area positive of SA-β-gal staining according to reference.²⁶

Behavior analysis

The larval behavioral testing was performed using the DanioVision system (Noldus, Wageningen, Netherlands). Zebrafish larvae from each experimental group (n = 18) were placed individually in 96-well plates with 150 μL of embryo water and allowed to acclimatize to the environment for 10 min. During the locomotor analysis, free-swimming speed was recorded for a 10-min light (visible light) period, followed by a 10-min dark (infrared light) period. The stress responses of individuals to light stimulus were tested by altering light on/off for flash, as well as the swimming behavior in response to vibration stimulus. Behavioral parameters were recorded and analyzed using the EthoVision software (Noldus, Wageningen, Netherland).

Measurement of ROS

ROS production in zebrafish embryos was analyzed using an oxidation-sensitive fluorescent probe dye, that is, 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) (Beyotime Biotechnology, Shanghai, China). Briefly, zebrafish were pretreated with different concentrations of TSG for 24 h and then exposed to 2 mM H₂O₂ for 4 h. After treatment, zebrafish embryos were further incubated with 10 μM DCFH-DA at 28.5°C in the dark for 30 min. After three rinses in embryo media, the stained embryos were viewed and photographed using a fluorescent microscope (Leica, Wetzlar, Germany). The fluorescence intensity was quantified using a fluorescence microplate reader (Molecular Devices Corporation, CA) for the ROS production among experimental groups.

Analysis of oxidative stress-related enzymes and peroxide

To evaluate the antioxidative activity of TSG in oxidative stress-induced aging zebrafish, we measured the activities of SOD and CAT, and the level of MDA. The experiment was performed according to the manufacturer's instructions (Beyotime Biotechnology, Shanghai, China).

Real-time quantitative polymerase chain reaction analysis

The total RNA of zebrafish embryos was extracted using Trizol reagent (Summerbio, Beijing, China) and reverse transcribed using the first-strand cDNA synthesis kit (ALLMEEK Technology Co., Ltd, Beijing, China). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed with SYBR QPCR Mixture (ALLMEEK Technology Co., Ltd, Beijing, China) on a Bio-RAD CFX Connect Real-time System (BioRad, CA). The RT-qPCR protocol was as follows: 30 s at 95°C for 30 s, 40 cycles at 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s. The specific sequences of primers used in this study are shown in Table 1. The 2^−ΔΔCt method was used to calculate the relative expression levels of target genes by normalizing them to that of β-actin.

Table 1.

Specific Sequences of Primers Used in Real-Time Quantitative Polymerase Chain Reaction

Gene name	Primer sequence (5′ to 3′)	Forward/reverse primer	Length (bp)
β-actin	GATGATGAAATTGCCGCACTG	Forward primer	21
β-actin	ACCAACCATGACCCTGATGT	Reverse primer	20
Bax	GCCTCGGCTGCATTCTGCTGAT	Forward primer	22
Bax	CTGCTGCCACGCCACCTCATAA	Reverse primer	22
Bcl2	AGGAAAATGGAGGTTGGGATG	Forward primer	21
Bcl2	TGTTAGGTATGAAAACGGGTGGA	Reverse primer	23
Caspase 3	CCGCTGCCCATCACTA	Forward primer	16
Caspase 3	ATCCTTTCACGACCATCT	Reverse primer	18
Cxcl-c1c	TCGCGGTAGTTTACGTCCAG	Forward primer	20
Cxcl-c1c	AGACATCTTCAGCGAGTCGG	Reverse primer	20
Il-1β	TTCCCCAAGTGCTGCTTATT	Forward primer	20
Il-1β	AAGTTAAAACCGCTGTGGTCA	Reverse primer	21
Il-6	CCTCAAACCTTCAGACCGCT	Forward primer	20
Il-6	GAACAGGATCGAGTGGACCG	Reverse primer	20
Il-8	GTGAAGCTCTACCTCCACCG	Forward primer	20
Il-8	AGGACGCATGCTTTTGAAAC	Reverse primer	20
Nqo1	CTGGGTGGTGTGTTTGAAGAA	Forward primer	21
Nqo1	GCTGTGGTAATGCCGTAGG	Reverse primer	19
Sod1	ATGGTGAACAAGGCCGTTTG	Forward primer	20
Sod1	AAAGCATGGACGTGGAAACC	Reverse primer	20
Sirt1	CAAGGAAATCTACCCCGGACAGT	Forward primer	23
Sirt1	CAGTGTGTCGATATTCTGCGTGT	Reverse primer	23
Serpine1	ATATGGTATCGCCTCGGTGC	Forward primer	20
Serpine1	TGGGCATTCCTCTTTCTTGC	Reverse primer	20
Tert	CGGTATGACGGCCTATCACT	Forward primer	20
Tert	TAAACGGCCTCCACAGAGTT	Reverse primer	20
Tnf-α	ACCAGGCCTTTTCTTCAGGT	Forward primer	20
Tnf-α	GCATGGCTCATAAGCACTTGTT	Reverse primer	22
Tgf-β	GTCCGAGATGAAGCGCAGTA	Forward primer	20
Tgf-β	TCAAATGAGAGCCAGCGGTT	Reverse primer	20

Statistical analysis

The graphs were drawn using Prism 5 GraphPad Software. All data were presented as mean ± standard error of the mean. Differences among experimental groups were evaluated by a two-way analysis of variance (ANOVA) with the Kruskal–Wallis post hoc test. A p-value <0.05 was considered statistical significance. Results were confirmed in three independent experiments.

Results

Protective effect of TSG on oxidative stress-induced premature aging in larval zebrafish

After pretreatment with different concentrations of TSG for 24 h, larval zebrafish were induced aging with the H₂O₂ solution (2 mM) for 4 h. Then, we collected the zebrafish samples from each group to analyze the age-related indicators. The most widely used biomarker for aging is senescence-associated β-galactosidase (SA-β-gal), with a high galactosidase activity detectable at pH 6.0 in senescent cells or tissues. Larval zebrafish in the H₂O₂ group showed significantly higher SA-β-gal activity than the control group, especially in the head and abdomen (Fig. 2A, B), indicating that H₂O₂ treatment increased the number of senescent cells. Concomitantly, the mRNA levels of aging-related genes, like sirtuin 1 (sirt1) and telomerase reverse transcriptase (tert), were decreased in the H₂O₂ group compared to the control group (p < 0.05 or 0.01) (Fig. 2C, D).

FIG. 2.

TSG pretreatment protected H₂O₂-induced aging in larval zebrafish. (A) Whole-body staining of SA-β-gal to detect cell senescence in larval zebrafish. Arrows, indicating SA-β-gal-positive cells that were stained blue-green. The images on the right were magnified 2.5 times of the left. (B) Quantitative analysis of SA-β-gal staining in zebrafish of various groups. (C-D) Expression changes of sirt1 (C), tert (D), and serpine1 (E) in larval zebrafish at mRNA levels. Data were presented as mean ± SEM. *p < 0.05 or **p < 0.01 versus control group; ^#p < 0.05 or ^##p < 0.01 versus H₂O₂ group. H₂O₂, hydrogen peroxide; SA-β-gal, senescence-associated β-galactosidase; SEM, standard error of the mean; sirt1, sirtuin 1; tert, telomerase reverse transcriptase; TSG, tetrahydroxystilbene glucoside.

As an inducer of cell senescence, the mRNA expression of serpine1 was upregulated in the H₂O₂ group (p < 0.05 vs. control group) (Fig. 2E). In contrast, TSG pretreatment (25–100 μg/mL) reduced evidently the number of senescent cells in oxidative stress-induced larvae zebrafish (Fig. 2A, B). Meanwhile, TSG statistically increased the expression of sirt1, but decreased serpine1 mRNA level in oxidative stress-induced larval zebrafish (p < 0.05 or 0.01 vs. H₂O₂ group) (Fig. 2C, E). TSG pretreatment had no significant effect on tert mRNA level.

Restoration of locomotor behavior and stimulus-response capacity in oxidative stress-induced aging larval zebrafish pretreated with TSG

Given that aging usually accompanies impaired swimming performance and reaction capacity in zebrafish,^11,27 we performed a light-dark locomotion test in which larval zebrafish were monitored for 20 min by light and vibration stimulus. Movement heatmaps showed that larval zebrafish had decreased swimming and motor impairments when exposed to H₂O₂ (Fig. 3A).

FIG. 3.

Effect of TSG on locomotor behavior of larval zebrafish induced by H₂O₂. (A) Heatmaps of behavior trajectory in larval zebrafish. (B–C) Average velocity (cm/s) of zebrafish larvae swimming in the light or dark. (D–E) Average velocity (cm/s) of larval zebrafish upon light-on or light-off flash stimulus during the 3-s test period. (F–G) Average velocity (cm/s) of larval zebrafish upon vibration stimulus during the 3-s test period. Data were presented as mean ± SEM. n = 18/group. *p < 0.05 or **p < 0.01 versus control group; ^#p < 0.05 or ^##p < 0.01 versus H₂O₂ group.

However, the larval zebrafish in each group exhibited normal activity as in the control group during the light period (Fig. 3B). In the dark period, the swimming velocity was significantly lower in the H₂O₂ group (0.22 cm/s) compared with the control group (0.35 cm/s) (p < 0.05 vs. control group), and it increased to 0.28 cm/s in the TSG-H group (p < 0.01 vs. H₂O₂ group) (Fig. 3C). Notably, when light-on or light-off for stimulus, H₂O₂ exposure statistically decreased the swimming speed by 50% and 22% in larval zebrafish, respectively (p < 0.05 or 0.01 vs. control group) (Fig. 3D, E).

When a vibration stimulus presented in the observation period, H₂O₂ exposure statistically decreased the swimming velocity by 27% in the light and 48% in the dark, respectively (Fig. 3F, G). TSG pretreatment recovered the above behavioral parameter changes in oxidative stress-induced larval zebrafish, especially in the TSG-H group. Compared with the H₂O₂ group, TSG pretreatment at 100 μg/mL increased significantly the moving speed by 49% upon light-on flash stimulus (p < 0.01 vs. H₂O₂ group) (Fig. 3D). When vibration stimulus presented in the TSG-H group, TSG pretreatment significantly increased the moving speed by 26% in the light and 32% in the dark (p < 0.01) (Fig. 3F, G), suggesting the ameliorative effect of TSG on locomotion defects in oxidative stress-induced aging zebrafish.

Inhibitory effect of TSG on oxidative stress-induced ROS generation in aging larval zebrafish

High levels of ROS are associated with the cellular damage and aging process of organisms.²⁴ Hence, we analyzed the ROS level of larval zebrafish in each group using an oxidation-sensitive fluorescent probe, DCFH-DA. Compared with the control group, the ROS level of larval zebrafish in the H₂O₂ group was markedly increased in liver and intestine tissues (Fig. 4A). However, TSG pretreatment (25–100 μg/mL) showed a significant decrease of ROS in oxidative stress-induced larval zebrafish (Fig. 4A). Quantitation in fluorescence imaging also showed that the level of ROS statistically elevated in the H₂O₂ group (p < 0.01 vs. control group), and TSG pretreatment dose-dependently reduced the intensity of ROS fluorescence in oxidative stress-induced zebrafish larvae (p < 0.01 vs. H₂O₂ group) (Fig. 4B).

FIG. 4.

TSG pretreatment suppressed H₂O₂-induced ROS generation in larval zebrafish. (A) Zebrafish were incubated with DCFH-DA and imaged by fluorescence microscope. (B) Quantitative analysis of ROS generation in whole zebrafish larvae. Data are presented as mean ± SEM. **p < 0.01 versus control group; ^##p < 0.01 versus H₂O₂ group. DCFH-DA, 2′,7′-dichlorodihydrofluorescein diacetate; ROS, reactive oxygen species.

Antiaging effect of TSG by alleviating oxidative damage in oxidative stress-induced larval zebrafish

Aging is partly triggered by the imbalance between ROS production and antioxidative defense in organisms.^23,28 SOD and CAT represent two main antioxidant enzymes. MDA is a lipid peroxidation product and a sensitive marker of oxidative stress. To confirm the antioxidative effect of TSG, we tested the activities of antioxidant enzymes in oxidative stress-induced aging zebrafish with or without TSG treatment.

As shown in Figure 5A and B, the remarkable decreases of SOD and CAT activities were detected in the H₂O₂ group (p < 0.05 or 0.01 vs. control group). Meanwhile, H₂O₂ induced a significant increment in MDA content (p < 0.05 vs. control group) (Fig. 5C). Although TSG treatment had no effect on the MDA level of the H₂O₂ group, it elevated the activities of both SOD and CAT in oxidative stress-induced larval zebrafish (p < 0.05 or 0.01) (Fig. 5A, B). Furthermore, the RT-qPCR results suggested that the expressions of sod1 and nqo1 were downregulated in the H₂O₂ group (p < 0.05 vs. control group), but were recovered after TSG pretreatment (p < 0.05 or 0.01 vs. H₂O₂ group).

FIG. 5.

TSG inhibited oxidative stress caused by H₂O₂ in aging larval zebrafish. (A) Enzymatic activity analysis of SOD. (B) Enzymatic activity analysis of CAT. (C) Content measurement of MDA. (D, E) mRNA expression of Sod1 (D) and Nqo1 (E) in larval zebrafish. Data are presented as the mean ± SEM. *p < 0.05 or **p < 0.01 versus control group; ^#p < 0.05 or ^##p < 0.01 versus H₂O₂ group. CAT, catalase; MDA, malondialdehyde; SOD, superoxide dismutase.

Inhibitory effect of TSG on inflammatory responses in oxidative stress-induced aging larval zebrafish

Aging usually accompanies a physical state of chronic inflammation.²⁹ To further investigate the underlying mechanism of TSG against aging, we examined the mRNA expressions of inflammation-related genes in aging larval zebrafish. H₂O₂ treatment significantly facilitated mRNA expressions of pro-inflammatory genes, including interleukin-1 beta (il-1β), interleukin 6 (il-6), chemokine (C-X-C motif) ligand C1c (cxcl-c1c), and interleukin 8 (il-8) (p < 0.01 vs. control group). Besides, H₂O₂ treatment also reduced mRNA level of transforming growth factor-beta (Tgf-β, an anti-inflammatory cytokine) (p < 0.05 vs. control group) (Fig. 6). Noticeably, TSG pretreatment reversed all the above changes in oxidative stress-induced aging larvae (Fig. 6).

FIG. 6.

TSG suppressed inflammatory responses in H₂O₂-induced aging larval zebrafish. The mRNA levels of inflammation-related genes in larval zebrafish were detected by RT-qPCR, including il-1β (A), il-6 (B), tnf-α (C), cxcl-c1c (D), il-8 (E), and tgf-β (F). Data are presented as the mean ± SEM. *p < 0.05 or **p < 0.01 versus control group; ^#p < 0.05 or ^##p < 0.01 versus H₂O₂ group. RT-qPCR, real-time quantitative polymerase chain reaction.

Cell senescence triggered by oxidative stress usually leads to cellular damage and subsequent cell apoptosis.^30,31 Hence, we also detected the mRNA expression of apoptosis-related markers (bcl-2, bax, and caspase-3). Results displayed that the mRNA levels of three genes had no dramatic alteration in the H₂O₂ group compared to the control group (Fig. 7A, B, D). Although the bcl-2/bax ratio was significantly decreased in oxidative stress-induced larval zebrafish (Fig. 7C) (p < 0.05 vs. control group), TSG did not affect apoptosis-related genes of aging zebrafish.

FIG. 7.

Effect of TSG on cell apoptosis in H₂O₂-induced aging larval zebrafish. (A) mRNA expression of bcl2 in larval zebrafish by RT-qPCR. (B) mRNA expression of bax in larvae zebrafish by RT-qPCR. (C) Ratio of bcl2/bax at the mRNA level. (D) mRNA expression of caspase3 in larval zebrafish by RT-qPCR. Data are presented as mean ± SEM. *p < 0.05 versus control group.

Discussion

With the aggravation of population aging, how to delay aging has become a research hotspot, and selecting appropriate animal models is vital for exploring the mechanism of aging and developing antiaging drug candidates.³² As a powerful vertebrate model for developmental and genetic studies, zebrafish has many similar aging characteristics to mammals for aging research.^25,33 Zhao et al. showed that depletion of Δ133p53 (a human p53 isoform) resulted in the long-term stress of ROS at a low level and finally led to accelerated brain aging in zebrafish.³⁴ Sirt1-knockout zebrafish attracted a significantly increased generation of ROS that was subsequently followed by apoptosis and aging.³⁵

In this study, we established oxidative damage-induced aging zebrafish by exposure of 96 hpf zebrafish larvae to H₂O₂. The aging zebrafish had more senescent cells, upregulated aging-promotive genes, and decreased antiaging genes (Fig. 2). Moreover, H₂O₂-treated larval zebrafish displayed a reduced swimming performance and slowed escape responses to external stimuli (Fig. 3), while TSG pretreatment effectively ameliorated these pathological symptoms. Thus, H₂O₂ exposure to larval zebrafish can establish the oxidative stress-induced aging model, while TSG pretreatment could alleviate the aging-related signals in aging zebrafish.

Cellular ROS are generated endogenously during the process of oxygen metabolism in cells, like superoxide anion (O₂^•−), hydroxyl radical (OH^•), and H₂O₂.²⁴ ROS may derive from interactions with exogenous sources, and their double-edged role in organisms is complicated. Low levels of ROS are necessary for activating the signaling pathways to initiate biological processes. On the contrary, higher levels of ROS and their long-time exposure will incur damage to cellular biomacromolecules such as DNA, lipids, and proteins. The accumulation of oxidative damage contributes to irreversible cell injury that causes ultimate cell death and aging onset.^23,36,37 In contrast, antioxidants can neutralize ROS and attenuate oxidative damage, thereby inhibiting aging process and preventing aging-related diseases.

Previously, the in vitro and in vivo results revealed that TSG had an antioxidant effect and hydroxyl radical-scavenging activity.^22,38,39 For instance, TSG can protect human brain microvascular endothelial cells from oxidative stress-induced dysfunction by inhibiting oxidative stress and inflammatory responses.³⁸ Also, TSG prevented glial cells (PC12 cells) from 6-hydroxydopamine-induced apoptosis by regulating the ROS-NO pathway.⁴⁰ Furthermore, TSG could alleviate oxidative stress-induced apoptosis and autophagy in mouse cochlear UB/OC-2 cells through the Nrf2 antioxidant pathway.⁴¹ In vivo experiments proved that TSG enhanced stress resistance to extend the life span of Caenorhabditis elegans.⁴²

Likewise, TSG acted as a potent antioxidant against D-galactose-induced aging in rats by increasing SOD activities and glutathione peroxidase.⁴³ These results imply the potential of TSG as a pharmaceutical antiaging drug. In this study, we further demonstrated that TSG exerted antioxidant activities in aging process by removing excess ROS and upregulating the mRNA expressions of antioxidant enzymes (SOD and CAT) and antioxidative genes (Sod1 and Nqo1) (Figs. 4 and 5). In summary, we confirmed that TSG had an antioxidative effect on aging zebrafish by strengthening oxidative resistance.

Chronic low-grade systemic inflammation is associated with the degenerative aging process and represents a significant risk factor for morbidity and mortality in the elderly.⁴⁴ Senescence-associated secretory phenotype (SASP) is a proinflammatory response linked to aging.⁴⁵ In aging mice and older adults, SASP factors are statistically increased, such as IL-1β, IL-6, IL-8, and tumor necrosis factor-α.^46,47 In previous studies, TSG has been proven effective in proinflammatory models. For example, TSG could increase mRNA levels of proinflammatory cytokines and activate the expression of Sirt1 to ameliorate ligature-induced periodontitis in rats.⁴⁸ TSG dramatically attenuated acetic acid-induced colon lesions by upregulating PPAR-γ and inhibiting NF-κB inflammatory pathway in mice.⁴⁹

In addition, Fan et al. demonstrated that TSG reduced the release of proinflammatory cytokines and blocked the p38/NF-κB signaling pathway to relieve Freund's adjuvant-induced chronic inflammatory pain in mice.⁵⁰ In parallel, our studies found that the antiaging effect of TSG contributed to its anti-inflammatory activities by regulating inflammation-associated gene expressions in aging zebrafish, including il-1β, il-6, cxcl-c1c, il-8, and Tgf-β (Fig. 6). Based on the above, TSG has an antiaging effect by suppressing the inflammatory responses in larval zebrafish.

Remarkably, TSG plays a neuroprotective role in Parkinson's disease by regulating Bax/Bcl-2 ratio and caspase-3 activity to inhibit apoptosis in MPP⁺-exposed cells.^51,52 However, we did not find the inhibitory effect of TSG on apoptosis in oxidative stress-induced aging zebrafish, partly due to the distinction between in vitro and in vivo studies or different disease models. It is also possible that the degree of apoptosis is relatively mild for oxidative stress-induced larval zebrafish since no significant difference in the caspase-3 activity occurred between the control and H₂O₂ groups (Fig. 7).

In conclusion, this study reveals that the aging model is established successfully by treating zebrafish with H₂O₂. Using this model, we demonstrated that TSG delayed aging process in oxidative stress-induced larval zebrafish. Furthermore, we explored the underlying mechanism of the TSG-initiated antiaging effect, indicative of the suppressed ROS production, enhanced expressions of antioxidant enzymes, and inhibited inflammatory responses in aging larval zebrafish. Summarily, our studies provide insight into the application of TSG for clinical treatment of aging or aging-related diseases.

Footnotes

Authors' Contributions

All authors contributed to the study conception and design. H.L. and X.Z. conceived and designed research. H.X. and X.C. conducted experiments and wrote the article. X.Y. and X.S. contributed new reagents or analytical tools. F.H. and M.C. analyzed data.

Ethical Approval

All animal experiments were approved by the animal ethics committee of Hubei University of Chinese Medicine and conducted following the Guiding Principles for the Care and Use of Laboratory Animals.

Disclosure Statement

No competing financial interests exist.

Funding Information

This work was supported by Hubei Provincial Department of Education (no. Q20192006).

References

Partridge

, Fuentealba

, Kennedy

. The quest to slow ageing through drug discovery. Nat Rev Drug Discov, 2020; 19(8):513–532; doi: 10.1038/s41573-020-0067-7

López-Otín

, Blasco

, Partridge

, et al. The hallmarks of aging. Cell, 2013; 153(6):1194–1217; doi: 10.1016/j.cell.2013.05.039

Palmer

, Xu

, Zhu

, et al. Targeting senescent cells alleviates obesity-induced metabolic dysfunction. Aging Cell, 2019; 18(3):e12950; doi: 10.1111/acel.12950

Villeda

, Plambeck

, Middeldorp

, et al. Young blood reverses age-related impairments in cognitive function and synaptic plasticity in mice. Nat Med, 2014; 20(6):659–663; doi: 10.1038/nm.3569

Smith

, Willemsen

, Popkes

, et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife, 2017; 6:e27014; doi: 10.7554/eLife.27014

Callaway

. ‘Young poo’ makes aged fish live longer. Nature, 2017; 544(7649):147; doi: 10.1038/nature.2017.21770

Omodei

, Fontana

. Calorie restriction and prevention of age-associated chronic disease. FEBS Lett, 2011; 585(11):1537–1542; doi: 10.1016/j.febslet.2011.03.015

Howe

, Clark

, Torroja

, et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature, 2013; 496(7446):498–503; doi: 10.1038/nature12111

Van Houcke

, De Groef

, Dekeyster

, et al. The zebrafish as a gerontology model in nervous system aging, disease, and repair. Ageing Res Rev, 2015; 24(Pt B):358–368; doi: 10.1016/j.arr.2015.10.004

10.

Henriques

, Carneiro

, Tenente

, et al. Telomerase is required for zebrafish lifespan. PLoS Genet, 2013; 9(1):e1003214; doi: 10.1371/journal.pgen.1003214

11.

Gilbert

, Zerulla

, Tierney

. Zebrafish (Danio rerio) as a model for the study of aging and exercise: Physical ability and trainability decrease with age. Exp Gerontol, 2014; 50:106–113; doi: 10.1016/j.exger.2013.11.013

12.

Tsai

, Tucci

, Uchiyama

, et al. Differential effects of genotoxic stress on both concurrent body growth and gradual senescence in the adult zebrafish. Aging Cell, 2007; 6(2):209–224; doi: 10.1111/j.1474-9726.2007.00278.x

13.

Hayes

, Reynolds

, Nowell

, et al. Spinal deformity in aged zebrafish is accompanied by degenerative changes to their vertebrae that resemble osteoarthritis. PLoS One, 2013; 8(9):e75787; doi: 10.1371/journal.pone.0075787

14.

Liu

, Wang

, Yang

, et al. Polygonum multiflorum thunb.: A review on chemical analysis, processing mechanism, quality evaluation, and hepatotoxicity. Front Pharmacol, 2018; 9:364; doi: 10.3389/fphar.2018.00364

15.

Bounda

, Feng

. Review of clinical studies of Polygonum multiflorum thunb. and its isolated bioactive compounds. Pharmacognosy Res, 2015; 7(3):225–236; doi: 10.4103/0974-8490.157957

16.

Chen

, Liu

, Lin

, et al. Anti-proliferative effect of an extract of the root of Polygonum multiflorum thunb. on MCF-7 human breast cancer cells and the possible mechanisms. Molecular medicine reports, 2011; 4(6):1313–1319; doi: 10.3892/mmr.2011.574

17.

, Zeng

, Tomlinson

. Evaluation of a crataegus-based multiherb formula for dyslipidemia: A randomized, double-blind, placebo-controlled clinical trial. Evidence-based complementary and alternative medicine: eCAM, 2014; 2014:365742; doi: 10.1155/2014/365742

18.

Sun

, Chen

, Cao

, et al. Polygonum multiflorum thunb extract extended the lifespan and healthspan of Caenorhabditis elegans via DAF-16/SIR-2.1/SKN-1. Food Funct, 2021; 12(18):8774–8786; doi: 10.1039/d1fo01908b

19.

, Matsumoto

, Murakami

, et al. Neuroprotective effects of Polygonum multiflorum on nigrostriatal dopaminergic degeneration induced by paraquat and maneb in mice. Pharmacol Biochem Behav, 2005; 82(2):345–352; doi: 10.1016/j.pbb.2005.09.004

20.

Wang

, Zhou

, Gong

, et al. In vitro and in situ study on characterization and mechanism of the intestinal absorption of 2,3,5,4′-tetrahydroxy-stilbene-2-O-β-D-glucoside. BMC Pharmacol Toxicol, 2020; 21(1):7; doi: 10.1186/s40360-020-0384-9

21.

Zhang

, Chen

. Biological effects of tetrahydroxystilbene glucoside: An active component of a rhizome extracted from Polygonum multiflorum. Oxid Med Cell Longev, 2018; 2018:3641960; doi: 10.1155/2018/3641960

22.

Wang

, Dai

, Gong

, et al. A review of pharmacology, toxicity and pharmacokinetics of 2,3,5,4′-tetrahydroxystilbene-2-O-β-D-glucoside. Front Pharmacol, 2022; 12:791214; doi: 10.3389/fphar.2021.791214

23.

Robert

, Wagner

. ROS-induced DNA damage as an underlying cause of aging. Adv Geriatr Med Res, 2020; 2(4):e200024; doi: 10.20900/agmr20200024

24.

Davalli

, Mitic

, Caporali

, et al. ROS, cell senescence, and novel molecular mechanisms in aging and age-related diseases. Oxidat Med Cell Longev, 2016; 2016:3565127; doi: 10.1155/2016/3565127

25.

, Wang

, Li

, et al. Protective effects of sal b on oxidative stress-induced aging by regulating the Keap1/Nrf2 signaling pathway in zebrafish. Molecules, 2021; 26(17):5239; doi: 10.3390/molecules26175239

26.

Kishi

, Bayliss

, Uchiyama

, et al. The identification of zebrafish mutants showing alterations in senescence-associated biomarkers. PLoS Genet, 2008; 4(8):e1000152; doi: 10.1371/journal.pgen.1000152

27.

, Tucci

, Kishi

, et al. Cognitive aging in zebrafish. PLoS One, 2006; 1(1):e14; doi: 10.1371/journal.pone.0000014

28.

Kregel

, Zhang

. An integrated view of oxidative stress in aging: Basic mechanisms, functional effects, and pathological considerations. Am J Physiol Regul Integr Comp Physiol, 2007; 292(1):R18–R36; doi: 10.1152/ajpregu.00327.2006

29.

Chung

, Kim

, Lee

, et al. Redefining chronic inflammation in aging and age-related diseases: Proposal of the senoinflammation concept. Aging Dis, 2019; 10(2):367–382; doi: 10.14336/ad.2018.0324

30.

Lee

, Wei

. Oxidative stress, mitochondrial DNA mutation, and apoptosis in aging. Exp Biol Med (Maywood, NJ), 2007; 232(5):592–606.

31.

Wang

, Chi

, Hu

, et al. Hydrogen sulfide-induced oxidative stress leads to excessive mitochondrial fission to activate apoptosis in broiler myocardia. Ecotoxicol Environ Safety, 2019; 183:109578; doi: 10.1016/j.ecoenv.2019.109578

32.

Mitchell

, Scheibye-Knudsen

, Longo

, et al. Animal models of aging research: Implications for human aging and age-related diseases. Annu Rev Anim Biosci, 2015; 3:283–303; doi: 10.1146/annurev-animal-022114-110829

33.

Kishi

, Uchiyama

, Baughman

, et al. The zebrafish as a vertebrate model of functional aging and very gradual senescence. Exp Gerontol, 2003; 38(7):777–786; doi: 10.1016/s0531-5565(03)00108-6

34.

Zhao

, Ye

, Tang

, et al. Loss-of-function of p53 isoform Δ113p53 accelerates brain aging in zebrafish. Cell Death Dis, 2021; 12(2):151; doi: 10.1038/s41419-021-03438-9

35.

Kim

, Jung

, Kim

, et al. Knockout of longevity gene Sirt1 in zebrafish leads to oxidative injury, chronic inflammation, and reduced life span. PLoS One, 2019; 14(8):e0220581; doi: 10.1371/journal.pone.0220581

36.

Bonomini

, Rodella

, Rezzani

. Metabolic syndrome, aging and involvement of oxidative stress. Aging Dis, 2015; 6(2):109–120; doi: 10.14336/ad.2014.0305

37.

Singh

, Kukreti

, Saso

, et al. Oxidative stress: A key modulator in neurodegenerative diseases. Molecules, 2019; 24(8):1583; doi: 10.3390/molecules24081583

38.

Jiang

, Wang

, Guo

. Tetrahydroxy stilbene glucoside ameliorates H2O2-induced human brain microvascular endothelial cell dysfunction in vitro by inhibiting oxidative stress and inflammatory responses. Mol Med Rep, 2017; 16(4):5219–5224; doi: 10.3892/mmr.2017.7225

39.

Xie

, Zhang

, Yin

, et al. Cognitive enhancing and antioxidant effects of tetrahydroxystilbene glucoside in Aβ1-42-induced neurodegeneration in mice. J Integrat Neurosci, 2018; 17(3–4):355–365; doi: 10.3233/jin-170059

40.

Tao

, Li

, Zhang

, et al. Protective effect of tetrahydroxystilbene glucoside on 6-OHDA-induced apoptosis in PC12 cells through the ROS-NO pathway. PLoS One, 2011; 6(10):e26055; doi: 10.1371/journal.pone.0026055

41.

, Lin

, Luo

, et al. 2,3,4′,5-tetrahydroxystilbene-2-O-β-D-glucoside (THSG) activates the Nrf2 antioxidant pathway and attenuates oxidative stress-induced cell death in mouse cochlear UB/OC-2 cells. Biomolecules, 2020; 10(3):465; doi: 10.3390/biom10030465

42.

Büchter

, Zhao

, Havermann

, et al. TSG (2,3,5,4′-tetrahydroxystilbene-2-O-β-D-glucoside) from the Chinese herb Polygonum multiflorum increases life span and stress resistance of Caenorhabditis elegans. Oxidat Med Cell Longev, 2015; 2015:124357; doi: 10.1155/2015/124357

43.

, Gu

, Tang

, et al. Antioxidant activity of stilbene glycoside from Polygonum multiflorum thunb in vivo. Food Chem, 2007; 104(4):1678–1681; doi: 10.1016/j.foodchem.2007.03.022

44.

Draganidis

, Jamurtas

, Chondrogianni

, et al. Low-grade systemic inflammation interferes with anabolic and catabolic characteristics of the aged human skeletal muscle. Oxidat Med Cell Longev, 2021; 2021:8376915; doi: 10.1155/2021/8376915

45.

Sanada

, Taniyama

, Muratsu

, et al. Source of chronic inflammation in aging. Front Cardiovasc Med, 2018; 5:12; doi: 10.3389/fcvm.2018.00012

46.

Singh

, Newman

. Inflammatory markers in population studies of aging. Ageing Res Rev, 2011; 10(3):319–329; doi: 10.1016/j.arr.2010.11.002

47.

, Xia

, Guo

, et al. Ginsenoside Rb1 retards aging process by regulating cell cycle, apoptotic pathway and metabolism of aging mice. J Ethnopharmacol, 2020; 255:112746; doi: 10.1016/j.jep.2020.112746

48.

Chin

, Hsieh

, Lin

, et al. 2,3,5,4′-tetrahydroxystilbene-2-O-β-glucoside isolated from polygoni multiflori ameliorates the development of periodontitis. Mediators Inflamm, 2016; 2016:6953459; doi: 10.1155/2016/6953459

49.

Zeng

, Xiao

, Chang

, et al. Beneficial effects of THSG on acetic acid-induced experimental colitis: Involvement of upregulation of PPAR-γ and inhibition of the Nf-Κb inflammatory pathway. Molecules, 2011; 16(10):8552–8568; doi: 10.3390/molecules16108552

50.

Fan

, Guan

, Luo

, et al. Tetrahydroxystilbene glucoside relieves the chronic inflammatory pain by inhibiting neuronal apoptosis, microglia activation, and GluN2B overexpression in anterior cingulate cortex. Mol Pain, 2018; 14:1744806918814367; doi: 10.1177/1744806918814367

51.

Zhang

, Sun

, Zhang

, et al. Tetrahydroxystilbene glucoside inhibits α-synuclein aggregation and apoptosis in A53T α-synuclein-transfected cells exposed to MPP. Can J Physiol Pharmacol, 2017; 95(6):750–758; doi: 10.1139/cjpp-2016-0209

52.

Zhang

, Huang

, Li

, et al. Potential molecular mechanisms mediating the protective effects of tetrahydroxystilbene glucoside on MPP(+)-induced PC12 cell apoptosis. Mol Cell Biochem, 2017; 436(1–2):203–213; doi: 10.1007/s11010-017-3169-8