Melatonin alleviates cognitive impairment via modulating NLRP3/Caspase 1 pathway in db/db mice

Abstract

Background

Activation of NLRP3 inflammasome has been implicated in cognitive impairment. Melatonin, known for its anti-inflammatory properties and traditional use in regulating circadian rhythms, is the focus of this study. This study intended to investigate the role of melatonin in diabetic cognitive impairment model.

Objective

The present study aimed to investigate the underlying mechanism of melatonin in alleviating diabetic cognitive impairment by suppressing NLRP3/Caspase 1 signaling pathway.

Methods

Cognitive function was assessed using Morris water maze test and Novel Object Recognition test. Apoptosis rate of hippocampal neurons was evaluated by TUNEL staining. Western blot was used to evaluate NLRP3/Caspase 1 pathway expression. Double immunofluorescence labelling of GFAP, Iba-1 or NeuN with NLRP3 respectively showed the localization of NLRP3 in hippocampus of db/db mice. In vitro, HT-22 cells treated with high glucose as cellular model were transfected with pc-DNA3.1-mNLRP3 or co-cultured with NLRP3 inhibitor MCC950 to elucidate NLRP3/Caspase 1 pathway in neuronal apoptosis regulation.

Results

Melatonin treatment improved cognitive function and morphologic abnormalities of hippocampal neurons. The double immunofluorescence labelling revealed melatonin inhibited NLRP3 inflammasome activation in hippocampal neurons rather than microglia or astrocytes. TUNEL staining and western blot showed melatonin markedly reversed the upregulation of NLRP3/Caspase 1 signaling pathway against neuronal apoptosis.

Conclusions

Melatonin attenuates diabetic cognitive impairment in db/db mice with down-regulation of NLRP3/Caspase 1 signaling pathway. In vivo and vitro studies supported that NLRP3 activation in hippocampal neurons was associated with diabetic cognitive impairment progression.

Keywords

Alzheimer's disease cognitive impairment db/db mice melatonin NLRP3 inflammasome

Introduction

Diabetes mellitus, characterized by elevated blood glucose levels, is a widespread chronic metabolic condition. The International Diabetes Federation (IDF) reports that the global diabetic population among adults aged 20–79 years numbered 537 million in 2021, with 90% suffering from type 2 diabetes mellitus (T2DM). Predictions suggest an increase to 643 million by 2030.¹ The risk of developing specific brain or mental disorders, particularly cognitive impairment, is increased among adults with T2DM.² Animal model studies suggest that the pathogenesis of diabetes-associated cognitive impairment involves a combination of vascular disease, defective central insulin signaling, neurodegeneration, and brain amyloidosis.^3,4

Dysfunction in regulating inflammation, oxidative responses, and synaptic plasticity were observed in the hippocampus of diabetic model in previous study.^5–7 The inflammatory response is increasingly recognized as a key role in the development and progression of diabetic cognitive impairment, with a particular focus on the involvement of inflammasome activation in neuroinflammation. Among the four inflammasome types in the CNS including NOD-like receptor pyrin domain-containing protein 1 (NLRP1), NLRP3, NLR family CARD domain-containing protein 4 (NLRC4) and absent in melanoma-2 (AIM2), CNS diseases were widely influenced by NLRP3.⁸ NLRP3 response to exogenous and endogenous pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) contributes to recruitment of the adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC) and the pro-caspase-1.⁹ This leads to activation of caspase-1 and the cleavage of gasdermin D (GSDMD), which is a membrane pore forming protein. The N-terminal region of GSDMD binds to the membrane allowing the release of IL-1β and IL-1.¹⁰ Excessive activation of NLRP3 inflammasome is tightly associated with many complications of diabetes. The activation of NLRP3/caspase-1/GSDMD pathway controls the neutrophil extracellular traps from neutrophils which delayed the wound healing of diabetic foot ulcer. NLRP3 gene silencing therapy ameliorated diabetic cardiomyopathy by inhibiting Caspase-1 and IL-1β activation.

Melatonin is synthesized and secreted by the pineal gland as well as other extrapineal organs, including immune system cells, brain, skin, and gastrointestinal tract.⁹ Melatonin plays vital roles in various physiological activities including regulation of circadian rhythms, immune responses, oxidative processes, apoptosis or mitochondrial homeostasis.¹⁰ Clinical studies demonstrated that serum melatonin is reduced in patients with chronic degenerative diseases like Alzheimer's disease,¹¹ depression,¹² and mild diabetes-associated cognitive impairment.¹³ Melatonin interferes inflammatory process by downregulating GSK3β/Nrf2 level.¹⁴ Melatonin reduced inflammatory cell aggregation and secretion of the inflammatory factors (IL-1β, IL-6) to attenuate rat intervertebral disc degeneration.¹⁵ A research indicated that melatonin ameliorates spatial memory deficit via modifying neuroinflammation in mice with traumatic brain injury.¹⁶ In addition, Melatonin inhibited inflammatory response of adipocytes and macrophages activation in obese mice.¹⁷

However, studies about the involvement of NLRP3 inflammasome activation in the pathogenesis of diabetes-associated cognitive impairment are rare. The present study aimed to i) explore the protective effects of melatonin in diabetic cognitive impairment mice, ii) investigate the relationship between melatonin treatment and NLRP3 inflammasome activation both in vivo and vitro, iii) determine the underlying mechanism of NLRP3/Caspase 1 signaling pathway in anti-inflammatory effect of melatonin.

Methods

Drugs

Melatonin (HY-B0075, MedChemExpress, USA) was dissolved in anhydrous ethanol and diluted with physiological saline solution or Dulbecco's modified Eagle's medium (DMEM) to the final concentration.

MCC950 (HY-12815, MedChemExpress, USA) dissolved in DMSO was used as a specific inhibitor of NLRP3 to explore the effect of melatonin on NLRP3 inhibition.

Animals and treatment

Twelve-week male specific-pathogen free (SPF) homozygote db/db mice (C57BLKS/J-leprdb/leprdb, n = 20) and age-matched heterozygote male db/m mice with normal blood glucose (C57BLKS/ J-leprdb/+, n = 20) were obtained from Changzhou Cavans Laboratory Animal CO.,Ltd(Jiangsu, China). The justification of male rats was based on the relatively longer distance between the urethral orifice and genitals compared with female rats. The animals were housed in individual cages with a 12:12 h day/night cycle, temperature controlled between 22 ± 1°C and free access to food and water. All experimental procedures were conducted according to the Guide for the Care and Use of Laboratory Animals. All protocols for animal treatment were approved by the Animal Ethics Committee of The Second Hospital of Hebei Medical University. A period of 2 weeks was allotted for the animals to acclimate to the laboratory environment before commencing the experiment.

The 40 mice were randomly divided into four groups to investigate the impact of melatonin: db/m + saline solution (n = 10), db/m + melatonin (20 µM/kg)^18,19 (n = 10), db/db + saline solution (n = 10), db/db + melatonin (20 µM/kg) (n = 10). Drugs were intraperitoneally administrated once daily for 6 weeks.

Behavioral tests

Morris water maze (MWM) test

The MWM test is a gold criterion for analyzing spatial learning and memory abilities in rodents.^20–22 The experimental system consists of a circular metal pool (150 cm in diameter and 60 cm in height), an automatic image acquisition and processing system. The pool was filled with opaque water containing skimmed milk powder at a temperature of 22 ± 2°C. The pool was surrounded by various distinct visual cues, with the platform located in the center of the southwest quadrant (10 cm in diameter) below the water surface. Mice were released randomly from four starting points (east, west, south, and north) with their heads facing the pool wall. The time taken to ﬁnd the hidden platform (escape latency) was recorded and analyzed over ﬁve consecutive days. Following the removal of the platform on day 6, the time spent in the target quadrant and the number of platform crossings were recorded and analyzed. Behavioral data were captured and analyzed using an automated image acquisition and processing system (SuperMaze software, Shanghai Xinruan Information Technology, Co., Ltd). Since MWM path varies remarkably, 10 mice in each group were chosen to test avoiding the deviation of results.

Novel Object Recognition (NOR) test

The NOR test is frequently utilized to assess the memory and cognitive abilities of animals, particularly in relation to object recognition and memory-related cognitive functions.^23–25 The experiment was based on mice are more likely to investigate unfamiliar objects. Each mouse was individually placed in a plexiglass white box of dimensions 40 cm × 40 cm × 30 cm. The mouse was trained to distinguish objects with various shapes. The experimental process was divided into three stages: adaptation, familiarization, and testing. The relative identification index was used to evaluate the learning and memory of the mice. The index was calculated by formula N/(N + F) × 100%, where N (new) indicates the time to explore the novel object, and F (familiar) represents the time to explore familiar objects.

Hematoxylin-eosin staining and Nissl staining

The brain tissues (n = 5 in each group) were ﬁxed in a 4% paraformaldehyde solution, then embedded in parafﬁn, and subsequently sliced into 5 µm thick sections of the hippocampus and cerebral cortex. Following this, the sections underwent hematoxylin and eosin staining (G1077 G1011, Servicebio, China) for 5 min each.²⁶

Nissl staining was carried out with 1% toluidine blue (G1086, Servicebio, China), for a duration of 30 min. Post-staining, the sections were washed, dehydrated, and sealed before being examined and imaged using an optical microscope from Zeiss, Germany.²⁷

Double immunofluorescence labelling

The frozen brain sections (5 µm) were fixed in 4% paraformaldehyde and ice-cold acetone respectively. After treating with 0.1% Triton X-100, and blocking with 5% goat serum (SL038, Solarbio, China), samples were incubated in primary antibodies for detecting NLRP3 (mouse, ABIN1169100, antibodies-online, Germany), NeuN (rabbit,ab177487,Abcam, dilution:1:500), GFAP (rabbit, ab7260, Abcam, dilution: 1:1000) and Iba1 (rabbit, ab178846, Abcam, dilution:1:1000) at 4°C overnight. After three washes with PBS, samples were incubated for 1 h in proper secondary antibodies at room temperature from light. After counterstaining with DAPI, immunofluorescence images were captured under a fluorescence confocal microscope (Zeiss, Germany).

Cell culture and treatment

Mouse hippocampal neuronal HT-22 cells obtained from Cell Resource Center, Peking Union Medical College were cultured in Dulbecco's modified Eagle's medium (DMEM) (11995, Solarbio, China) supplemented with 10% fetal bovine serum (11011–8611, Solarbio, China) and 1% penicillin-streptomycin (P1400, Solarbio, China) in a humidified incubator with 5% CO2 at 37°C. Seven experimental groups were established in 6-well plates: CON (25 mM glucose) group, CON + pcDNA3.1-vector group, CON + pcDNA3.1-mNLRP3 group, HG (75 mM glucose) group, HG + Mel (20 nM melatonin) group, HG + Mel + pcDNA3.1-mNLRP3 group, and HG + MCC950 (10 nM) group. Pharmacological agents were administered concurrently with glucose exposure: melatonin (prepared in 0.01% ethanol, final solvent concentration <0.001%) and MCC950 (dissolved in DMSO, final concentration 10 nM). Vehicle controls confirmed no solvent-induced effects. The pcDNA3.1-vector plasmid and pcDNA3.1-mNLRP3 plasmid were obtained from Shanghai Gengsi Biotechnology Co., Ltd After 24 h of high-glucose treatment, cells were exposed to Transfection Reagent (E2691, Promega, USA) for transient transfection experiments. Transfection reagent and DNA were sequentially introduced to the medium without antibiotics and incubated at room temperature for 5 min and 15 min respectively. Cells were maintained for 48 h with medium replenishment at 24-h intervals. Post incubation, cells were harvested for downstream analyses.

Quantitative real time polymerase chain reaction (QRT-PCR)

Total RNA was extracted by the 6 min high-quality RNA Extraction Kit (ZS-M11005, ZHONGSHI TONGCHUANG, China) and reversed by reverse-transcribed into cDNA with the PrimeScript RT reagent kit (ZHONGSHI TONGCHUANG, China). The quantity and quality of RNA were assessed by A260/A280 ratio. The primers utilized in this study are listed in Table 1.

Table 1.

Primers for QRT-PCR.

Genes		Primers (5′-3′)
Caspase1	Forward	ATACAACCACTCGTACACGTCTTGC
	Reverse	TCCTCCAGCAGCAACTTCATTTCTC
IL-1β	Forward	CACTACAGGCTCCGAGATGAACAAC
	Reverse	TGTCGTTGCTTGGTTCTCCTTGTAC
GSDMD	Forward	ACTGAGTCCACAGCCAAGAGG
	Reverse	GCCACTCGGAATGCCAGGATG
NLRP3	Forward	GCTCGCATCAACAGGCGAGAC
	Reverse	CCATCCACTCTTCTTCAAGGCTGTC
GAPDH	Forward	AGGTCGGTGTGAACGGATTTG
	Reverse	TGTAGACCATGTAGTTGAGGTCA

Western blot analysis

Hippocampal tissues were lysed in RIPA buffer (BB3201, Bestbio, Shanghai, China). A BCA kit (Beyotime) was used to determine protein concentration. Equal amounts of protein samples were isolated with SDS-PAGE gel, followed by transferred onto PVDF membranes. Then 5% skim milk was used to block the membranes for 1 h. The membranes were incubated at 4°C overnight with primary antibodies including mouse monoclonal anti-mouse NLRP3 antibody (ABIN1169100, antibodies-online,Germany,1:100), rabbit polyclonal anti-mouse Caspase1 antibody (ab138483, Abcam, USA; dilution: 1:1000), rabbit polyclonal anti-mouse IL-1b antibody (ab18955, Abcam, USA; dilution: 1:1000) or β-actin (AC043, Abclonal; dilution: 1:100000). Afterwards, the membranes were incubated with corresponding secondary antibodies for 1 h. Immunoreactive bands were visualized using the enhanced chemiluminescence detection system (Aplegen Gel Company, Inc., USA). The signal intensities were analyzed using ImageJ Software.

Enzyme-linked immunosorbent assay (ELISA)

Serum samples from mice and supernatants of cells (n = 5 in each group) were collected for the detection of inﬂammatory factor concentrations using IL-1β ELISA kit (KE10003, Proteintech, USA). The test was performed according to the manual instruction.

TUNEL staining

For TUNEL staining, HT-22 cells were incubated with TUNEL reaction mixture (MK1014-100, Boster Biological Technology, China) according to the manual instruction. DAPI was used to counterstain the sections for 4 min. The positive cells were observed using a fluorescence microscope.

Immunofluorescence staining for NLRP3 specks in HT-22 cells

HT-22 cells of each group were fixed using a 4% paraformaldehyde followed by permeabilization and blocking with 5% normal goat serum containing 0.3% Triton X-100. subsequently, the cells were incubated in primary antibody against NLRP3 (mouse-anti NLPR3, ABIN1169100, antibodies-online, Germany, 1:100) to detect the NLRP3 protein expression in HT-22 cells. One hour incubation at room temperature with a FITC-conjugated Goat Anti-Mouse IgG (H + L) Antibody (K1201, APEXBIO). DAPI was used to visualize cell nuclei. The images of the NLRP3 specks were observed by using a fluorescence microscope.

Statistical analysis

The data were presented as the mean ± standard error and analyzed using GraphPad Prism version 8 (GraphPad Software, La Jolla, CA, USA). Two-way repeated measures analysis of variance (ANOVA) was employed to demonstrate the statistical differences of means within each treatment group at the speciﬁc time points for the MWM tests. Group variations were assessed using one-way ANOVA followed by Turkey's multiple comparison tests. All p values <0.05 were considered statistically signiﬁcant.

Results

Changes of body weight and blood glucose in db/db mice administered melatonin

To investigate the effect of melatonin on body weight and fasting blood glucose in diabetic mice, db/db mice were administrated melatonin treatment (20 mg/kg) for 6 weeks, and body weight and fasting blood glucose were measured on the 7th, 14th, 21st, 28th, 35th, and 42nd days. As expected, db/db mice showed significant increases in blood glucose and body weight. Blood glucose and body weight of db/db +20mel group were lower than those of db/db group (blood glucose: 29.67 ± 0.10 mmol/L versus 33.09 ± 0.14 mmol/L, p < 0.05; body weight: 53.7 ± 0.22 g versus 58 ± 0.46 g, p < 0.05), showing the advantages of melatonin in lowering blood glucose and weight in type 2 diabetic mice.

Melatonin treatment ameliorated diabetes-associated cognitive impairment

Cognitive function was evaluated by MWM test and NOR test. During the MWM assessment, a notable difference in escape latency time was observed in the db/db group starting from day 2 to day 5 compared with the db/m group (Figure 1A and B). The statistical analysis comparing crossing and swimming times in the platform quadrant on day 5 is illustrated in Figure 1C and D. Mice in the db/db group exhibited significantly shorter platform crossing times compared to the db/m group (p < 0.001). The db/db + MEL group exhibited a signiﬁcantly higher number of crossing times compared to the db/db group (p < 0.05). Likewise, the db/db group demonstrated a signiﬁcantly lower percentage of time spent swimming in the platform quadrant in comparison to the db/m group (p < 0.001). The db/db + MEL group displayed a signiﬁcant increase in the percentage of time spent swimming in the platform quadrant as opposed to the db/db group (p < 0.05). Additionally, as illustrated in Figure 1E, a reduced discrimination index was evident in the db/db group (p < 0.05). Collectively, these findings indicate that melatonin administration restored cognitive function decline in db/db mice.

Figure 1.

Melatonin improves cognitive inpairment in db/db mice. (A) representative swimming trace during the spatial probe test. (B)Escape latency of the hidden-platform test. (C) Number of target crossing in the probe trial. (D) The percentage of total time spent in target quadrant in the probe trial.(E) Discrimination index of the db/db mice.All data are expressed as means ± SEM for 10 mice in each group. *P < 0.05, compared with the db/m group. # P < 0.05, compared with the db/db mice.(C)HE staining in the hippocampal DG, CA1 rigions and cortex.(D)Nissl staining in the hippocampal DG, CA1 rigions and cortex. (n = 3,Scale bar = 50 μm).

Protective effect of melatonin against pathological deficits in the hippocampus of db/db mice

HE staining was performed to examine the effects of melatonin on neuronal loss and damage in the hippocampus of db/db mice. As shown in Figure 1F, well-arranged and intact hippocampal pyramidal cells were observed in hippocampal dentate gyrus (DG) region, CA1 region, CA3 region and cortex in db/m group. In contrast, deformed neurons, karyopyknosis and cavitation presented in the corresponding regions in db/db mice. After melatonin treatment, disarranged neuron cells were reduced in db/db mice. Nissl staining indicated a reduction in Nissl bodies, disrupted cellular structure, and neural impairment in the db/db group in contrast to the db-m group. Following MEL intervention, the count of Nissl bodies was restored in cortex and different regions of hippocampus (Figure 1G). Overall, these results proved that melatonin could protect hippocampal neurons from neuronal injuries in db/db mice (Table 2).

Table 2.

Comparisons of body weights and blood glucose levels in four groups of mice.

Group	Body weight (g)	Fasting blood glucose levels (mmol/L)
db/m	35.59 ± 0.25	8.41 ± 0.20
db/m + 20mel	34.89 ± 0.38	8.19 ± 0.14
db/db	58 ± 0.46	33.09 ± 0.14***
db/db + 20mel	53.7 ± 0.22	29.67 ± 0.10^$$

Comparisons of body weights and blood glucose levels in four groups of mice (n = 10 in each group). ***p < 0.001 compared with db/m group; ^$$p < 0.01 compared with db/db group; Data are presented as the mean ± SEM.

Melatonin inhibits the expression of the NLRP3/Caspase 1 signaling pathway in the hippocampus of db/db mice

Double immunofluorescence labelling in db/m group and db/db group showed that NLRP3 proteins were mainly colocalized in hippocampal neurons (Figure 2C) instead of astrocytes (Figure 2A and D) or microglia (Figure 2B and E), which was consistent with the results of previous study.²⁸ Melatonin treatment decreased the fluorescence intensity of NLRP3 in the neurons of DG (Figure 2F) in db/db mice. Furthermore, QRT-PCR and western blot results demonstrated that expression levels of NLRP3, GSDMD, Caspase-1 and IL-1β increased significantly in the hippocampus of db/db mice, compared with db/m mice (p < 0.001, Figure 3A, B and D). Melatonin prevented the aggravation of NLRP3/Caspase 1 signaling pathway in db/db mice (p < 0.001, Figure 3A, B and D). In addition, increased levels of IL-1β in the hippocampal tissues of db/db mice were reversed by melatonin treatment (p < 0.01, Figure 3C). These outcomes suggested that melatonin treatment could inhibited NLRP3/Caspase 1 pathway which mediated inflammasome activation and neuronal inflammation in db/db mice.

Figure 2.

The cellular location of NLRP3 in the hippocampus of different groups for the double immunofluorescence labelling. (A) Immunofluorescence images of DG showed the expression of NLRP3 in GFAP-positive astrocyte. (B) Immunofluorescence images of DG showed the expression of NLRP3 in Iba-1-positive microglial. (C) Immunofluorescence images of DG showed the expression of NLRP3 in Neun-positive neuron.(n = 3 in each group;Scale bars =50 μm). (D) Relative NLRP3-positive microglial intensity.(E)Realative NLRP3-positive astrocyte intensity.(F)Relative NLRP3-positive neuron intensity. ***P < 0.001, compared with the db/m group. # #P < 0.01, compared with the db/db mice.

Figure 3.

Melatonin inhibits NLRP3/Caspase 1 signaling pathway in the hippocampus of db/db mice. (A) QPCR analysis of NLRP3, GSDMD, Caspase-1 and IL-1b in the hippocampus of each group. (B) Representative protein bands and Western blot analysis of NLRP3, GSDMD, Caspase-1 and IL-1β in the hippocampus of each group. (C) Expression of IL-1β in the hippocampus of each group was measured by ELISA kit. (D) Western blot analysis of NLRP3, GSDMD-N, Caspase-1 and in the hippocampus of each group. Values are represented as means ± SEM for three mice in each group. *** P < 0.001, compared with the db/m group. ##P < 0.01, ###P < 0.001, compared with the db/db group.(n = 10 in each group).

Melatonin attenuated the activation of NLRP3/Caspase 1 signaling pathway in high-glucose exposure to HT-22 cells

Mouse hippocampal neuron cell line HT-22 exposed to high-glucose was used as cellular model of hippocampus in diabetic condition. The TUNEL assay confirmed that melatonin could ameliorate neuronal apoptosis in high-glucose group (Figure 4A). To evaluate whether melatonin suppressed NLRP3 activation in high-glucose exposed HT-22 cells, NLRP3 expression were analyzed by QRT-PCR and cell immunofluorescence. The outcomes showed that mRNA expressions of NLRP3, GSDMD, Caspase-1, and IL-1β were markedly enhanced by high glucose induction, which was significantly suppressed by melatonin treatment or NLRP3 inhibitor MCC950 (p < 0.001, Figure 4E). Melatonin treatment reversed the expression of key proteins in NLRP3/Caspase 1 signaling pathway in high glucose exposed HT-22 cells, which confirmed the effect of melatonin in suppressing neuronal inflammation (p < 0.05, Figure 4C and E). Additionally, ELISA assay indicated an increased IL-1β level in high glucose exposed HT-22 cells, in contrast to melatonin reducing IL-1β level in high glucose exposed group. In pcDNA-mNLRP3 group with NLRP3 overexpression, the anti-inflammatory effect of melatonin was diminished. The results proved that melatonin exerted anti-inflammatory effects through NLRP3/Caspase 1 signaling pathway (p < 0.05, Figure 4C–E). These findings suggested that melatonin inhibited high glucose-induced neuronal apoptosis and inflammation through inhibiting NLRP3/Caspase1 pathway.

Figure 4.

Melatonin inhibited cell apoptosis through inhibiting NLRP3/Caspase1 pathway. (A) Cell apoptosis was determined by TUNEL staining. (B) Immunofluorescence images of NLRP3 (green)/DAPI (blue) colocalization in hippocampal neuronal HT-22 cells at 48 h after treatment with 25 mmol/L glucose or 75 mmol/L glucose in the absence or presence of pc-DNA3.1-mNLRP3 (n = 3,Scale bar = 50 μm). (C) Relative fluoresence intensity of NLRP3 in each group. (D) Levels of IL-1β in each group was measured by ELISA kit. (E) QRT-PCR analysis of NLRP3, Caspase-1, GSDMD, IL-1β in hippocampal neuronal HT-22 cells in each group. Values are represented as means ± SEM .*** P < 0.001, compared with the 25Glu group. # P < 0.05, ## P < 0.01, ### P < 0.001, compared with the 75 Glu group.$ P < 0.05, $$ P < 0.01, $$$ P < 0.001, compared with 75Glu + 20mel.

Discussion

The present study demonstrated that (1) melatonin treatment significantly ameliorated diabetes-associated cognitive impairment, hyperglycemia, and overweight in db/db mice, (2) melatonin treatment significantly attenuated deformation and apoptosis of hippocampal neurons both in vivo and vitro, and (3) melatonin treatment suppressed the activation of NLRP3 inflammasome and attenuated hippocampal inflammatory responses. Overall, melatonin treatment significantly attenuated hippocampal neuron damage and alleviated cognitive impairment in diabetic db/db mice through inhibition of NLRP3/Caspase 1 signaling pathway (Figure 5). Hyperglycemia induced the activation and expression of NLRP3, which subsequently interacts with ASC and Caspase-1, forming the NLRP3 inflammasome complex. The NLRP3 inflammasome complex facilitates Caspase-1-mediated cleavage of GSDMD into two fragments: the N-terminal and C-terminal regions. Concurrently, active Caspase-1 initiates the processing of pro-IL-1β and pro-IL-18. The N-terminal region of GSDMD binds to the membrane, forming a pore essential for the release of IL-1β and IL-18, leading to neuronal apoptosis. Melatonin mitigates IL-1β and IL-18 production by suppressing the NLRP3/Caspase-1 signaling pathway activation in neurons, thereby conferring neuroprotection against diabetes.

Figure 5.

Schematic illustration of the mechanism of melatonin inhibition on NLRP3/Caspase-1 signaling pathway. High glucose strongly stimulates the activation and increased expression of NLRP3, which binds to ASC and Caspase-1 to assemble into NLRP3 inflammasome complex. NLRP3 inflammasome complex allows Caspase-1 to cleave GSDMD into two fragments: the N-terminal region and the C-terminal region. The active Caspase-1 also start the cleavage of pro-IL-1β and pro-IL-18. The N-terminal region of GSDMD binds to the membrane and form a pore. This pore is necessary for the release of IL-1β and IL-18, which induces neuronal apoptosis. Melatonin reduces the production of IL-1β and IL-18 by inhibiting the activation of NLRP3/Caspase-1 signaling pathway in neurons, thereby exerting neuroprotection against diabetes.

The present study clarified the neuroprotective effect of melatonin in db/db mice. Db/db mice as a type 2 diabetic model exhibited typical hippocampus-dependent memory impairment is widely used in diabetic cognitive decline research. Therefore, db/db mice were selected for investigating the pathogenesis of diabetes-related cognitive impairment and for screening potential drugs.²⁹ Female rodents exhibit cyclical hormonal fluctuations (estrous cycle) that may confound metabolic and inflammatory measurements.³⁰ And our lab's prior work established has already used male db/db model as diabetic cognitive impairment model.³¹ Therefore we choose male db/db model to maintain consistency with our previous investigations.

One of the main chronic complications in T2DM is progressive deterioration of cognitive function. The available epidemiological data demonstrates a high estimated prevalence of cognitive impairment among individuals with T2DM worldwide.³² Since the publication of the 2014 IDF guideline,³³ which was the first guideline to address the detection and management of diabetic cognitive dysfunction or dementia, diabetes-associated cognitive impairment has garnered increased attention from clinicians and researchers. While metformin and dulaglutide have exhibited promise in improving cognition in individuals with mild to moderate cognitive impairment in T2DM, their clinical efficacy remains to be fully elucidated.^34,35 Our team is committed to investigating the pathogenesis of cognitive impairment in diabetes and exploring alternative medications to alleviate cognitive decline. It is imperative to identify potential drugs for treating diabetes-related cognitive deficits. The mechanisms underlying the efficacy of DL-3-n-butylphthalide (NBP) and troxerutin in ameliorating diabetic cognitive impairment have been elucidated.^5,31

Melatonin, a substituted indoleamine derived from tryptophan, was first isolated from the pineal gland of a cow by Lerner and colleagues in 1958.³⁶ Melatonin is notably involved in regulating physiological functions such as sleep, circadian rhythms and neuroendocrine. Recently, melatonin has been employed in the delay of several degenerative processes. Melatonin has been suggested as a promising candidate for enhancing osteoarthritis and myocardial injury by inhibiting chondrocyte apoptosis and reducing inflammatory responses.^37,38 Neuroprotective effects of melatonin have been revealed in Huntington's disease mice with neurodegeneration.³⁹ Melatonin inhibition of NLRP3 inflammasome in regulation of NF-κB Nucleocytoplasmic transport ameliorated postoperative cognitive dysfunction.⁴⁰ However, its role in preventing cognitive impairment associated with diabetes remains unclear. This led us to propose that melatonin may have a potential effect against cognitive impairment associated with diabetes.

MWM is the gold standard for assessing spatial learning and memory in rodents. Melatonin significantly reduced escape latency and enhanced the number of crossings in the target quadrant, aligning with prior research findings.⁴¹ We demonstrated that db/db mice exhibited hippocampal neuronal deformation and decreased Nissl body number accompanied with increased neuronal apoptosis. Previous studies have identified several mechanisms of hippocampal damage in neurodegenerative diseases, including oxidative stress, mitochondrial dysfunction, and inflammatory responses.⁴² The ELISA result of hippocampus tissue extracts revealed an increase in IL-1β level in db/db mice, which was reduced by melatonin treatment. As a key pro-inflammatory factor in vivo, IL-1β is involved in diverse autoimmune inflammatory responses and various cellular activities including cell apoptosis. The secretion of IL-1β is governed by exogenous PAMPs and endogenous DAMPs. PAMPs and DAMPs need to bind to membrane Toll-like receptors (TLRs) or intracellular NOD-like receptors (NLRs) for their action. Growing evidence has characterized that hyperactivation of NLRP3 inflammasome is involved in various inflammatory diseases.⁴³ PAMPs and DAMPs stimulate upregulation of NLRP3 expression, which contributes to the recruitment of ASC and pre-Caspase-1 to form a complex.⁴⁴ This leads to activation of Caspase-1 and cleavage of gasdermin D (GSDMD). As a membrane pore-forming protein, the N-terminal region of GSDMD binds to the membrane and allows the release of the pro-inflammatory cytokines IL-1β and IL-18.⁴⁵ MCC950, a recently identified inhibitor of the NLRP3 inflammasome, has shown promise in mitigating cognitive impairment and exerting neuroprotective effects.²⁸ MCC950 specifically inhibits NLRP3 inflammasome activation and IL-1β secretion by suppressing NLRP3-induced ASC oligomerization.⁴⁶ It has been reported that NLRP3 activation triggered by Aβ aggravated IL-1β releasing and pathogenesis of AD.⁴⁷ Consequently, we assumed that neuroinflammation in the hippocampus is associated with the development of cognitive dysfunction in db/db mice.

NLRP3/Caspase 1 signaling pathway activation was identified in the hippocampus of db/db mice, including upregulation of NLRP3, GSDMD, Cleaved-caspase-1 and IL-1β by western blot and QRT-PCR analysis. Melatonin administration for 6 weeks led to the suppression of the NLRP3/Caspase 1 pathway in db/db mice, along with an improvement in cognition. The findings highlight the significance of the NLRP3/Caspase 1 signaling pathway in the hippocampus regarding diabetes-related cognitive impairment. A recent study revealed that inhibition of NLRP3 inflammasome activation relieves motor deficits and nigrostriatal dopaminergic degeneration through Nrf2/NLRP3/Caspase 1 pathway in aged mice.⁴⁸ Isoflurane increased IL-18 and IL-1β secretion by activating the NLRP3/Caspase 1 pathway in aged mouse microglial cells.⁴⁹ These findings demonstrated NLRP3 is a critical factor concerning aged-related cognitive impairment.

In the cytoplasm, inflammasomes are detected in a broad range of cell types, comprising immune cells like macrophages, dendritic cells, T cells, and B cells, along with neuronal cells and glial cells such as microglia and astrocytes. Some studies have shown the predominant localization of the NLRP3 inflammasome in microglia within the central nervous system, whereas others have suggested its presence in astrocytes and neurons. In lipopolysaccharide challenged neuroinflammation-related cognitive impairment model, NLRP3 inflammasome activation was found in microglia of hippocampus.⁹ Interestingly, we found NLRP3 colocalized with NeuN (neuronal marker) more than Iba1 (microglia marker) in high glucose group in vitro. In vivo, double immunofluorescence labelling of NeuN and NLRP3 revealed that NLRP3 expression level in neurons is parallel to the severity of hippocampal neural damage and cognitive decline in db/db mice. Melatonin reversed NLRP3/Caspase 1 signaling pathway in neurons, along with alleviated hippocampal neural damage and cognitive decline in vitro and vivo. A comparable investigation demonstrated that FGF21 mitigates neurodegeneration by diminishing neuroinflammation and oxidative stress through the regulation of the NF-κB pathway and the AMPKα/AKT pathway in neurons.⁵⁰ A previous study showed that Meisoindigo alleviated brain damage in ischemic stroke by suppressing NLRP3 inflammasome in neurons via TLR4/NF-κB signaling pathway.⁴⁵ Based on the present results, we speculated that NLRP3 upregulation and activation in hippocampal neurons may lead to neuron apoptosis and cognitive impairment in db/db mice. Melatonin exerted a protective effect on diabetic cognition through NLRP3/Caspase 1 signaling pathway in hippocampal neurons in T2DM.

In vitro, the protective effect of melatonin in high glucose HT-22 cells was reversed by NLRP3-overexpressed plasmid, which is confirmed by increased level of IL-1β. The specific inhibitor of NLRP3 MCC950 was employed as positive control in high glucose group, which indicated that the NlLRP3 inhibition was directly correlated with neuronal apoptosis and neuroinflammation reduction. Similarly, TUNEL assays showed more apoptotic cells in the high glucose group than in the control group, which was partly reversed by melatonin and MCC950. The increased expression of NLRP3, GSDMD, Cleaved-caspase-1 and IL-1β were observed both in high glucose group and NLRP3-overexpressed group. Melatonin reduced the expression levels of these molecules, consistent with NLRP3 inhibitor MCC950. Thus, the in- vitro experiments suggested that melatonin protected hippocampal neuronal damage and apoptosis through NLRP3 and its downstream pathway.

The present study has two potential limitations. Melatonin exerts many of its functions by binding to the MT1 and MT2 G-protein-coupled membrane receptors initiating diverse signaling mechanisms.^51–53 These receptors are found in multiple organs of the body, comprising the central nervous system, retina, liver, gut, and skin. Since melatonin was administrated intraperitoneally, the involvement effects of other organs on cognitive function cannot be excluded, such as the microbiota-gut-brain axis.^54,55 Secondly, we only examined the inhibitory effect of melatonin on the NLRP3/Caspase 1 signaling pathway. Further investigations are required to examine the impact of melatonin on additional signaling pathways, including TGF-β, MAPK, and NF-κB pathways.³⁷

Overall, our study demonstrated that melatonin exerted neuroprotective effects on diabetes-associated cognitive impairment by effectively inhibiting NLRP3/Caspase 1 signaling pathway. These results suggest that melatonin may be a promising candidate for combating cognitive dysfunction in diabetes.

Footnotes

Acknowledgements

We would like to thank Hebei Key Laboratory of Rare Disease and Hebei Key Laboratory of Neurophysiology for the technical support. The authors would like to thank professor Sheng Wang for his kind support in this project.

ORCID iD

Ming Gao

Ethical considerations

All experimental procedures were conducted according to the Guide for the Care and Use of Laboratory Animals. All protocols for animal treatment were approved by the Animal Ethics Committee of Hebei Medical University.

Consent to participate

Not applicable

Consent for publication

Not applicable

Author contributions

Ming Gao: Conceptualization; Formal analysis; Investigation; Project administration; Writing – review & editing.

Jinting Chen: Data curation; Investigation; Resources.

Beiyao Zhang: Investigation.

Jie Li: Data curation; Investigation; Resources.

Jiadong Lang: Investigation; Methodology; Resources.

Xin Zhao: Formal analysis; Investigation.

Qiangqiang Zhang: Investigation.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Natural Science Foundation of Hebei Province, Health and Medical Science Research Project of Hebei, (grant number nos. H2021206452, nos.H2021206187, no.20200908).

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability statement

Data will be made available on request.

References

Wang

Peng

Zhao

, et al. Prevalence and treatment of diabetes in China, 2013–2018. JAMA 2021; 326: 2498–2506.

van Sloten

Sedaghat

Carnethon

, et al. Cerebral microvascular complications of type 2 diabetes: stroke, cognitive dysfunction, and depression. Lancet Diabetes Endocrinol 2020; 8: 325–336.

Zhang

, et al. Effects of L-3-n-butylphthalide on cognitive dysfunction and NR2B expression in hippocampus of streptozotocin (STZ)-induced diabetic rats. Cell Biochem Biophys 2015; 71: 315–322.

Hamed

. Brain injury with diabetes mellitus: evidence, mechanisms and treatment implications. Expert Rev Clin Pharmacol 2017; 10: 409–428.

Gao

, et al. DL-3-n-butylphthalide (NBP) ameliorates cognitive deficits and CaMKII-mediated long-term potentiation impairment in the hippocampus of diabetic db/db mice. Neurol Res 2019; 41: 1024–1033.

Bellia

Lombardo

Meloni

, et al. Diabetes and cognitive decline. Adv Clin Chem 2022; 108: 37–71.

Zhang

Bai

, et al. L-3-n-butylphthalide attenuates cognitive deficits in db/db diabetic mice. Metab Brain Dis 2019; 34: 309–318.

Heneka

McManus

Latz

. Inflammasome signalling in brain function and neurodegenerative disease. Nat Rev Neurosci 2018; 19: 610–621.

Arioz

Tastan

Tarakcioglu

, et al. Melatonin attenuates LPS-induced acute depressive-like behaviors and microglial NLRP3 inflammasome activation through the SIRT1/Nrf2 pathway. Front Immunol 2019; 10: 1511.

10.

Tian

Liu

Jing

, et al. Huang-Lian-Jie-Du decoction attenuates cognitive dysfunction of rats with type 2 diabetes by regulating autophagy and NLRP3 inflammasome activation. J Ethnopharmacol 2022; 292: 115196.

11.

Zhang

Wan

, et al. Melatonin regulates Aβ production/clearance balance and Aβ neurotoxicity: a potential therapeutic molecule for Alzheimer's disease. Biomed Pharmacother 2020; 132: 110887.

12.

Tuunainen

Kripke

Elliott

, et al. Depression and endogenous melatonin in postmenopausal women. J Affect Disord 2002; 69: 149–158.

13.

Zhang

Zhu

, et al. Association of serum melatonin level with mild cognitive impairment in type 2 diabetic patients: a cross-sectional study. Int J Endocrinol 2021; 2021: 5566019.

14.

Das

Balmik

Chinnathambi

. Melatonin reduces GSK3β-mediated tau phosphorylation, enhances Nrf2 nuclear translocation and anti-inflammation. ASN Neuro 2020; 12: 1759091420981204.

15.

Zhang

Chen

, et al. Melatonin modulates IL-1β-induced extracellular matrix remodeling in human nucleus pulposus cells and attenuates rat intervertebral disc degeneration and inflammation. Aging (Albany NY) 2019; 11: 10499–10512.

16.

Lin

Liu

, et al. Melatonin ameliorates spatial memory and motor deficits via preserving the integrity of cortical and hippocampal dendritic spine morphology in mice with neurotrauma. Inflammopharmacology 2020; 28: 1553–1566.

17.

Liu

Gan

Zhang

, et al. Melatonin alleviates adipose inflammation through elevating α-ketoglutarate and diverting adipose-derived exosomes to macrophages in mice. J Pineal Res 2018; 64: e12455.

18.

Gao

Sun

Wei

, et al. Protective effect of melatonin against metabolic disorders and neuropsychiatric injuries in type 2 diabetes mellitus mice. Phytomedicine 2024; 131: 155805.

19.

Mansouri

Salari

Abedi

, et al. Melatonin treatment improves cognitive deficits by altering inflammatory and neurotrophic factors in the hippocampus of obese mice. Physiol Behav 2022; 254: 113919.

20.

Yao

Hao

, et al. Melatonin alleviates depression-like behaviors and cognitive dysfunction in mice by regulating the circadian rhythm of AQP4 polarization. Transl Psychiatry 2023; 13: 310.

21.

Long

, et al. Melatonin attenuates chronic sleep deprivation-induced cognitive deficits and HDAC3-Bmal1/clock interruption. CNS Neurosci Ther 2024; 30: e14474.

22.

Wang

Cao

, et al. Melatonin alleviates acute sleep deprivation-induced memory loss in mice by suppressing hippocampal ferroptosis. Front Pharmacol 2021; 12: 708645.

23.

Xian

, et al. Chronic colitis exacerbates NLRP3-dependent neuroinflammation and cognitive impairment in middle-aged brain. J Neuroinflammation 2021; 18: 153.

24.

Yin

Tang

Wang

, et al. HMGB1 Mediates synaptic loss and cognitive impairment in an animal model of sepsis-associated encephalopathy. J Neuroinflammation 2023; 20: 69.

25.

Liang

Kang

Zhang

, et al. Knockdown and inhibition of hippocampal GPR17 attenuates lipopolysaccharide-induced cognitive impairment in mice. J Neuroinflammation 2023; 20: 271.

26.

Shi

, et al. Liraglutide improves lipid metabolism by enhancing cholesterol efflux associated with ABCA1 and ERK1/2 pathway. Cardiovasc Diabetol 2019; 18: 146.

27.

Shi

Liu

, et al. Danggui-Shaoyao-San improves cognitive impairment through inhibiting O-GlcNAc-modification of estrogen α receptor in female db/db mice. J Ethnopharmacol 2021; 281: 114562.

28.

Ward

Abdul

, et al. NLRP3 Inflammasome inhibition with MCC950 improves diabetes-mediated cognitive impairment and vasoneuronal remodeling after ischemia. Pharmacol Res 2019; 142: 237–250.

29.

Chen

Liang

Zhan

, et al. Zibupiyin recipe protects db/db mice from diabetes-associated cognitive decline through improving multiple pathological changes. PLoS One 2014; 9: e91680.

30.

Beery

Francis

. Adaptive significance of natural variations in maternal care in rats: a translational perspective. Neurosci Biobehav Rev 2011; 35: 1552–1561.

31.

Gao

Kang

Zhang

, et al. Troxerutin attenuates cognitive decline in the hippocampus of male diabetic rats by inhibiting NADPH oxidase and activating the Nrf2/ARE signaling pathway. Int J Mol Med 2020; 46: 1239–1248.

32.

You

Liu

Chen

, et al. The prevalence of mild cognitive impairment in type 2 diabetes mellitus patients: a systematic review and meta-analysis. Acta Diabetol 2021; 58: 671–685.

33.

Dunning

Sinclair

Colagiuri

. New IDF guideline for managing type 2 diabetes in older people. Diabetes Res Clin Pract 2014; 103: 538–540.

34.

Weinstein

Davis-Plourde

Conner

, et al. Association of metformin, sulfonylurea and insulin use with brain structure and function and risk of dementia and Alzheimer's disease: pooled analysis from 5 cohorts. PLoS One 2019; 14: e0212293.

35.

Cukierman-Yaffe

Gerstein

Colhoun

, et al. Effect of dulaglutide on cognitive impairment in type 2 diabetes: an exploratory analysis of the REWIND trial. Lancet Neurol 2020; 19: 582–590.

36.

Lerner

Case

Takahashi

. Isolation of melatonin and 5-methoxyindole-3-acetic acid from bovine pineal glands. J Biol Chem 1960; 235: 1992–1997.

37.

Zhang

Liu

Yang

, et al. Melatonin: a novel candidate for the treatment of osteoarthritis. Ageing Res Rev 2022; 78: 101635.

38.

Wei

, et al. Melatonin alleviates lipopolysaccharide-induced myocardial injury by inhibiting inflammation and pyroptosis in cardiomyocytes. Ann Transl Med 2021; 9: 413.

39.

Jauhari

Baranov

Suofu

, et al. Melatonin inhibits cytosolic mitochondrial DNA-induced neuroinflammatory signaling in accelerated aging and neurodegeneration. J Clin Invest 2020; 130: 3124–3136.

40.

Zhu

Zhang

Xiao

, et al. Melatonin-driven nlrp3 inflammation inhibition via regulation of NF-κB nucleocytoplasmic transport: implications for postoperative cognitive dysfunction. Inflammation 2023; 46: 1471–1492.

41.

Cao

Liu

, et al. Modafinil protects hippocampal neurons by suppressing excessive autophagy and apoptosis in mice with sleep deprivation. Br J Pharmacol 2019; 176: 1282–1297.

42.

Rizzo

Di Meo

Polito

, et al. Cognitive impairment and type 2 diabetes mellitus: focus of SGLT2 inhibitors treatment. Pharmacol Res 2022; 176: 106062.

43.

Wang

Hauenstein

. The NLRP3 inflammasome: mechanism of action, role in disease and therapies. Mol Aspects Med 2020; 76: 100889.

44.

Coll

Schroder

Pelegrín

. NLRP3 And pyroptosis blockers for treating inflammatory diseases. Trends Pharmacol Sci 2022; 43: 653–666.

45.

Jin

Zhang

, et al. Meisoindigo protects against focal cerebral ischemia-reperfusion injury by inhibiting nlrp3 inflammasome activation and regulating microglia/macrophage polarization via TLR4/NF-κB signaling pathway. Front Cell Neurosci 2019; 13: 553.

46.

Yang

Wang

Kouadir

, et al. Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors. Cell Death Dis 2019; 10: 128.

47.

Hong

Liu

, et al. The neuroprotection of progesterone against Aβ-induced NLRP3-Caspase-1 inflammasome activation via enhancing autophagy in astrocytes. Int Immunopharmacol 2019; 74: 105669.

48.

Zhang

Zhao

Wang

, et al. The Nrf2-NLRP3-caspase-1 axis mediates the neuroprotective effects of Celastrol in Parkinson's disease. Redox Biol 2021; 47: 102134.

49.

Wang

Meng

Cao

, et al. Critical role of NLRP3-caspase-1 pathway in age-dependent isoflurane-induced microglial inflammatory response and cognitive impairment. J Neuroinflammation 2018; 15: 109.

50.

Kang

Wang

, et al. FGF21 Attenuates neurodegeneration through modulating neuroinflammation and oxidant-stress. Biomed Pharmacother 2020; 129: 110439.

51.

Dubocovich

Delagrange

Krause

, et al. International union of basic and clinical pharmacology. LXXV. Nomenclature, classification, and pharmacology of G protein-coupled melatonin receptors. Pharmacol Rev 2010; 62: 343–380.

52.

Ekmekcioglu

. Melatonin receptors in humans: biological role and clinical relevance. Biomed Pharmacother 2006; 60: 97–108.

53.

Witt-Enderby

Bennett

Jarzynka

, et al. Melatonin receptors and their regulation: biochemical and structural mechanisms. Life Sci 2003; 72: 2183–2198.

54.

Liu

, et al. Melatonin alleviates neuroinflammation and metabolic disorder in DSS-induced depression rats. Oxid Med Cell Longev 2020; 2020: 1241894.

55.

Wang

Cao

, et al. Gut microbiota-derived metabolites mediate the neuroprotective effect of melatonin in cognitive impairment induced by sleep deprivation. Microbiome 2023; 11: 17.