Preconception Hydroxychloroquine Therapy Restores Placental Function and Improves Pregnancy Outcomes in Obstetric Antiphospholipid Syndrome

Abstract

Aims:

Obstetric antiphospholipid syndrome (OAPS), a representative autoimmune disorder driven by antiphospholipid antibodies (aPLs), afflicts 30% of patients with refractory to conventional antithrombotic treatment. Hydroxychloroquine (HCQ) offers adjunctive potential, yet its mechanistic action and critical treatment timing remain undefined. This study establishes the preventive efficacy of preconception HCQ initiation (HCQ-pre) and deciphers its fundamental rescue pathways in OAPS.

Results:

Clinical data suggested a potential advantage of HCQ-pre compared to post-conception administration (HCQ-post) in optimizing pregnancy outcomes for patients with OAPS. Modeling the pathology of OAPS using human trophoblast organoids revealed that HCQ-pre effectively reverses aPLs-mediated trophoblast dysfunction: increasing cytotrophoblast proliferation (Ki67⁺/TP63⁺) by 20% and restoring their differentiation into extravillous trophoblast (HLA-G⁺) to 93% of control levels, while HCQ-post shows markedly limited efficacy. Mechanistically, HCQ-pre preemptively corrected aPLs-induced redox imbalance by rescuing hypoxia-inducible factor 1-alpha-mediated hypoxia and replenishing antioxidant mediators (NRF2/SOD2/GPX4) via Hippo/YAP and Wnt/β-catenin signaling. Murine OAPS models established that HCQ-pre restores placental perfusion (90% of control levels) by enhancing spiral artery remodeling—with diminished efficacy observed at post-conception administration—thereby attenuating hypoperfusion-induced hypoxic damage and improving pregnancy outcomes.

Innovation and Conclusions:

We redefine HCQ as a proactive placental resetter that neutralizes oxidative stress barriers preconception, thereby liberating trophoblast differentiation capacity. This work positions HCQ-pre as the critical intervention phase—a paradigm shift from reactive adjunct to preemptive root-cause interception, providing the mechanistic foundation for optimizing OAPS management through timely individualized prophylaxis. Antioxid. Redox Signal. 44, 748–769.

Keywords

obstetric antiphospholipid syndrome hydroxychloroquine preconception therapy redox imbalance trophoblast differentiation pregnancy outcomes organoids

Introduction

Obstetric antiphospholipid syndrome (OAPS), a representative autoimmune disorder driven by antiphospholipid antibodies (aPLs), represents a critical challenge in maternal-fetal medicine, manifesting as recurrent miscarriage (50%), preeclampsia (PE, 19%), and fetal growth restriction (FGR, 15–30%) (Alijotas-Reig et al., 2015; Huo et al., 2024). While aPLs are detected in merely 1–5% of healthy women, their prevalence escalates to 10–29% among those experiencing adverse pregnancies, underscoring their role as a pivotal risk factor for placental dysfunction (Yang et al., 2024). Although conventional antithrombotic therapy (aspirin/heparin) improves pregnancy outcomes in some patients, 20–30% exhibit refractory OAPS unresponsive to this regimen, highlighting an unmet need for targeted interventions (Kaneko et al., 2022). Emerging evidence now redefines OAPS pathogenesis beyond coagulation dysfunction and thrombosis, emphasizing oxidative stress-mediated placental injury—manifested through aPLs-induced redox imbalance, impaired trophoblast differentiation, and defective spiral artery (SA) remodeling—as a central driver of pathological pregnancy (D’Ippolito et al., 2023; Vornic et al., 2024; Yu et al., 2015).

Hydroxychloroquine (HCQ), a repurposed immunomodulatory agent, has garnered attention for its potential to improve live birth rates (67% vs. 57%) and reduce placental complications (47% vs. 63%) among patients with autoimmune diseases (Gerde et al., 2021; Sciascia et al., 2016). Research has shown that HCQ antagonizes aPLs binding to Toll-like receptors on trophoblasts (Choi et al., 2022; Marchetti et al., 2014), reactivates antioxidant defenses such as nuclear respiratory factor 2 (NRF2), and suppresses inflammasome-driven inflammation (Basri et al., 2024; McCarthy et al., 2016). However, its chronic pharmacokinetic profile, which necessitates 40–60 days to attain therapeutic efficacy, poses a clinical dilemma: guidelines advocate preconception initiation for patients with systemic lupus erythematosus (SLE), yet the heterogeneity of OAPS manifestations and the lack of mechanistic evidence for optimal timing fuel persistent disputes over whether HCQ should be administered pre- or post-conception (Dernoncourt et al., 2024; Yoo-Min et al., 2024), rendering current practice in OAPS largely evidence-limited and empirically driven(Ambati et al., 2023; Tektonidou et al., 2019).

Crucially, the temporal dimension and mechanism of HCQ action remain poorly understood. Traditional 2D trophoblast models fail to recapitulate the complexity of placental development, while ethical constraints limit access to first-trimester human tissues. To address this, we leveraged 3D trophoblast organoids, which incorporate all placental trophoblast subtypes (Pascual, 2022), to model aPLs-induced oxidative dysfunction. Our data revealed that preconception HCQ initiation (HCQ-pre), which outperforms post-conception administration (HCQ-post), rescues cytotrophoblast (CTB) proliferation and restores their differentiation into extravillous trophoblast (EVT) by suppressing hypoxia-inducible factor 1-alpha (HIF1α)-mediated hypoxic injury and restoring antioxidant mediators (NRF2/SOD2/GPX4). These findings were further validated in OAPS murine models, where HCQ-pre-enhanced SA remodeling and mitigated placental hypoperfusion damage through oxidative injury suppression, ultimately leading to improved pregnancy outcomes.

Innovation

Residual pregnancy failure in refractory OAPS necessitates precision intervention beyond conventional treatment. Building on the therapeutic potential of HCQ, we characterize HCQ-pre as the critical intervention phase—a proactive placental redox modulator that preemptively mitigates oxidative stress preconception, thereby liberating trophoblast differentiation potential with comparatively diminished efficacy observed in post-conception initiation. This work elevates HCQ from empirical adjunct to prophylactic cornerstone, emphasizing the importance of preconception detection of aPLs and redox profiling to enable patients with OAPS stratification, thereby optimizing pregnancy outcomes. These mechanistic insights advocate for clinical protocol refinement toward preconception pathogenesis targeting, facilitating the clinical translation of individualized management for autoimmune pregnancy failure.

Overall, our study establishes that HCQ-pre acts as a “redox reset” mechanism, preemptively dismantling oxidative stress barriers to safeguard trophoblast differentiation trajectories before embryo implantation. By integrating clinical retrospection, organoid technology, and in vivo validation, we highlight that preconception antioxidant restoration may serve as a therapeutic paradigm for OAPS, while simultaneously providing a theoretical basis for the suitable clinical use of HCQ.

Results

Graphic summary illustration

HCQ-pre administration prophylactically rescues aPLs-impaired trophoblast differentiation trajectories by preemptively reversing placental redox imbalance—specifically targeting HIF1α-mediated hypoxic injury and antioxidant depletion (NRF2/SOD2/GPX4)—through Hippo/YAP and Wnt/β-catenin signaling. This essential therapeutic intervention preserves physiological trophoblast differentiation trajectories prior to embryo implantation, thereby facilitating SA remodeling, alleviating placental hypoperfusion-induced hypoxic damage, and mitigating pregnancy outcomes in OAPS to optimize clinical deployment, as detailed in Figure 1.

FIG. 1.

Schematic “redox reset” mechanisms by HCQ-pre restoring placental function and improving pregnancy outcomes in OAPS. HCQ-pre administration prophylactically rescues aPLs-induced trophoblast differentiation trajectories by preemptively reversing placental redox imbalance—specifically targeting HIF-1α-mediated hypoxic injury and antioxidant depletion (NRF2/SOD2/GPX4)—through Hippo/YAP and Wnt/β-catenin signaling. This essential therapeutic intervention preserves physiological trophoblast differentiation trajectories prior to embryo implantation, thereby facilitating SA remodeling, alleviating placental hypoperfusion-induced hypoxic damage, and mitigating pregnancy outcomes in OAPS to optimize clinical deployment. GPX4, glutathione peroxidase 4; HCQ, hydroxychloroquine; HCQ-pre, preconception HCQ initiation; NRF2, nuclear respiratory factor 2; OAPS, obstetric antiphospholipid syndrome; SA, spiral artery; SOD2, superoxide dismutase 2; YAP, Yes-associated protein. (schematic illustrations created using BioRender).

Therapeutic outcomes of HCQ-pre versus HCQ-post initiation in OAPS

The clinical retrospective analysis compared clinical characteristics and pregnancy outcomes among 87 patients with OAPS stratified by HCQ initiation timing—29 untreated (HCQ-non), 31 preconception-initiated (HCQ-pre), and 27 postconception-initiated (HCQ-post)—alongside 30 healthy controls (HC). As detailed in Table 1, no intergroup differences were observed in terms of maternal age and aPLs profiles among the three groups of patients with OAPS, confirming baseline disease severity. Following adjustment for key confounders affecting HCQ administration in OAPS (age, aPLs positivity [anti-β2GP1, aCL, and LA], and history of adverse pregnancy outcomes [abortions ≤ 10 weeks, fetal losses > 10 weeks, preeclampsia, and FGR]), both HCQ-pre and HCQ-post demonstrated statistically significant improvements versus HCQ-non across primary endpoints (p < 0.05): reduction of total adverse outcomes—particularly early abortions (≤10 weeks) and fetal/placental weight rescue, confirming HCQ’s efficacy robustness against confounding (Table 1). Critically, confounder-adjusted effect magnitudes (represented by the Estimates in Supplementary Table S1) revealed a biologically consistent advantage for preconception initiation: HCQ-pre generated substantially larger absolute benefits than HCQ-post in abortion reduction (≤10 weeks; 4.40 vs. 3.56), total adverse outcomes reduction (3.53 vs. 1.94), gestational age extension (9.41 vs. 7.31), fetal weight rescue (1193.46 vs. 874.94), and placental weight rescue (200.89 vs. 155.27). This convergence of larger effect magnitudes across interrelated developmental domains (fetal growth, placental function, pregnancy duration) provides evidence for superior efficacy of HCQ-pre.

Table 1.

Clinical Characteristics and Pregnancy Outcomes among the Pregnant Women Who Participated

		OAPS (n = 87)
		OAPS without HCQ	OAPS with HCQ-pre	OAPS with HCQ-post
Characteristics mean ± SD/n (%)/M (p25, p75)	HC (n = 30)	(HCQ-non, n = 29)	(HCQ-pre, n = 31)	(HCQ-post, n = 27)
Age (years)	29.60 ± 2.55	30.10 ± 3.12	30.26 ± 3.20	30.11 ± 3.42
aPLs profiles
anti-β2GPI (CU)	3.40 (1.65,5.82)	20.16 (8.61,24.88)	20.65 (16.32,28.61)	23.12 (16.35,27.65)
anti-β2GPI positive (n)	0	15 (51.72%)	22 (70.97%)	19 (70.37%)
aCL (CU)	2.98 (1.34,4.38)	11.32 (5.27,22.17)	20.37 (5.16,24.64)	20.46 (10.32,28.16)
aCL positive (n)	0	10 (34.48%)	17 (54.84%)	16 (59.26%)
LA	0.96 (0.93,0.98)	1.02 (0.95,1.31)	1.06 (0.98,1.31)	1.09 (1.09,1.31)
LA positive (n)	0	11 (37.93%)	14 (45.16%)	12 (44.44%)
History of adverse pregnancy
Abortions ≤ 10wk (n)	0	3 (10.34%)	11 (35.48%)	10 (37.04%)
Fetal losses > 10wk (n)	0	1 (3.45%)	3 (9.68%)	2 (7.41%)
Preeclampsia (n)	0	1 (3.45%)	2 (6.45%)	2 (7.41%)
FGR (n)	0	0	1 (3.23%)	1 (3.70%)
Pregnancy outcomes
Abortions ≤ 10wk (n)	0	6 (20.69%)	1 (3.23%)^b	2 (7.41%)^a
Fetal losses > 10wk (n)	0	2 (6.90%)	0	1 (3.70%)
Preterm live births (n)	0	3 (10.34%)	1 (3.23%)	1 (3.70%)
Pregnancy complications (n)	0	6 (20.69%)	1 (3.23%)	2 (7.41%)
FGR (n)	0	3 (10.34%)	0	1 (3.70%)
Preeclampsia (n)	0	3 (10.34%)	1 (3.23%)	1 (3.70%)
Gestational age (wk)	39.07 (38.86,39.75)	38.00 (15.65,39.28)	39.00 (38.14, 39.71)^b	38.86 (37.71, 39.71)^a
Fetal birth weight (g)	3425.00 (3250.00, 3650.00)	3100.00 (0, 3250.00)	3350.00 (3100.00, 3650.00)^c	3250.00 (3000.00, 3450.00)^b
Placental weight (g)	570.00 (540.00, 600.00)	510.00 (0, 550.00)	550.00 (530.00, 600.00)^c	540.00 (500.00, 570.00)^b

Results are expressed as Means ± SD, n (%), and M (p25, p75); n, number of patients. Confounding factors for age, aPLs positivity (anti-β2GP1, aCL, and LA), and history of adverse pregnancy (abortions ≤ 10 weeks, fetal losses > 10 weeks, preeclampsia, and FGR) were adjusted for in the statistical comparison of pregnancy outcomes between: (i) HCQ-pre and HCQ-non, (ii) HCQ-post and HCQ-non, and (iii) HCQ-pre and HCQ-post.

p < 0.05 vs. HCQ-non.

^bp < 0.01 vs. HCQ-non.

^cp < 0.001 vs. HCQ-non.

aCL, anti-cardiolipin antibodies; anti-β2GP1, anti-β2glycoprotein1 antibodies; aPLs, antiphospholipid antibodies; FGR, fetal growth restriction; HC, healthy control; HCQ, hydroxychloroquine; HCQ-non, OAPS without HCQ; HCQ-post, OAPS with HCQ post-conception; HCQ-pre, OAPS with HCQ preconception; LA, lupus anticoagulant; OAPS, obstetric antiphospholipid syndrome; SD, standard deviation.

Post-hoc power analysis further validated high statistical power for HCQ-pre versus HCQ-non comparisons across primary endpoints (Power_value >90%), whereas HCQ-post versus HCQ-non comparisons showed a degree of statistical reliability (Power_value, 71% to 82%). Direct HCQ-pre vs. HCQ-post comparisons did not reach statistical significance under current sample size constraints, as power for some indicators fell below the ideal 80% threshold. Nevertheless, the consistent gradient of larger confounder-adjusted effect magnitudes favoring HCQ-pre remains biologically and clinically compelling, warranting large-scale randomized trials and mechanistic studies to elucidate the pharmacologic basis of HCQ’s timing-dependent efficacy (Supplementary Table S1).

aPLs-Triggered oxidative stress disrupts trophoblast spatial differentiation in OAPS placentas

As shown in Figure 2A, normal development of placental trophoblast villi and SA remodeling by EVT are critical for maintaining a healthy pregnancy. Pathological analysis of placental tissues from persistently aPLs-positive patients with OAPS compared to matched HC (n = 6 fields/group) revealed placental ischemia with compromised proliferative capacity, evidenced by terminal villous dysplasia, elevated fibrinoid deposition within the intervillous space, and significantly reduced Ki67 expression (Fig. 2B, C). Molecular profiling identified profound hypoxic damage and redox imbalance associated with these phenotypic alterations in OAPS group versus HC group: hypoxia-sensitive indicators (iNOS, HIF-1α, HO-1) were significantly elevated, whereas antioxidant defense mediators (NRF2, SOD2, GPX4) were suppressed (p < 0.05; Fig. 2D–I). Given the crucial role of oxidative stress in affecting placental trophoblast differentiation and invasion (Bagchi and Bagchi, 2024), our immunofluorescence (IF) co-localization analysis detected predominant heme oxygenase (HO-1) overexpression within cytokeratin 7 (CK7)⁺ marked trophoblasts in the OAPS group. This was accompanied by EVT-specific differentiation defects, evidenced by a 30% reduction in human leucocyte antigen-G (HLA-G) expression (p = 0.0054). Critically, the co-localization ratio of HO-1⁺/HLA-G⁺ staining (denoting oxidatively damaged EVTs) surpassed 85% in OAPS—markedly exceeding the 70% observed in HC (Pearson’s Coefficient, p = 0.02; Fig. 2J–M). Spatial IF co-localization further confirmed inducible nitric oxide synthase (iNOS)-superoxide dismutase (SOD2) dysregulation and attenuated NRF2-mediated antioxidant cytoprotection within trophoblast compartments in OAPS, with quantitative assays revealing significant elevations in HO-1, iNOS, and significant reductions in SOD2 and NRF2 (p < 0.05; Fig. 2N–Q). Collectively, these results establish that aPLs-induced oxidative stress disrupts trophoblast differentiation and EVT functionality, driving placental pathogenesis in OAPS.

FIG. 2.

aPLs-triggered oxidative stress disrupts trophoblast spatial differentiation in OAPS placentas. (A) Schematic of placental trophoblast development and SA remodeling. (B, C) Representative H&E and IHC staining and quantification of Ki67 expression in placentas. (D–F) IHC staining and quantification of HIF-1α, HO-1, GPX4, and SOD2 expression in the HC and OAPS groups. (G–I) Protein expression levels of hypoxia-sensitive indicators (iNOS, HIF-1α, and HO-1) and antioxidant defense mediators (NRF2, SOD2, and GPX4). (J–M) IF co-localization staining and quantification analysis of HO-1 alongside CK7 (marker of trophoblasts) or HO-1 alongside HLA-G (marker of EVT) in placentas (Data present Pearson’s Coefficient and Overlap Coefficient). (N–Q) IF staining and quantification analysis of SOD2 alongside iNOS or NRF2 alongside HO-1. Scale bars = 50 μm. (Data present mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, two-tailed unpaired Student’s t-test). aPLs, antiphospholipid antibodies; CK7, cytokeratin 7; EVT, extravillous trophoblast; H&E, hematoxylin and eosin; HIF-1α, hypoxia-inducible factor 1-alpha; HLA-G, human leucocyte antigen-G; HO-1, heme oxygenase; IF, immunofluorescence; IHC, immunohistochemistry. (schematic illustrations created using BioRender).

Dose-dependent spatial remodeling of trophoblast organoids (TOs) by aPLs unveils Oxidation-Hypoxia circuitry

Employing an optimized trophoblast organoid medium (TOM), modified from the Turco protocol (Sheridan et al., 2020), we established proliferative TOs with trophoblast identity validated by canonical markers GATA-binding protein 3 and CK7 (Fig. 3A, B; Supplementary Fig. S2A-D). These organoids contained three distinct trophoblast lineages: proliferating CTB marked by Ki67⁺/TP63⁺, multinucleated syncytiotrophoblast (STB) marked by CD71⁺, and HLA-G⁺ marked EVT induced by EVT medium (EVTM#1/EVTM#2). Lineage specificity was confirmed through IF staining and flow cytometry (FC) (Fig. 3C, D; Supplementary Fig. S2E, F). To model OAPS pathology, organoids were treated with clinically relevant concentrations of monoclonal aPLs (10/20/50 μg/mL) (Liu et al., 2022). Compared to the HC group, dose-dependent cytopathology was observed: 10 μg/mL aPLs intervention group: No significant alterations except a 20% reduction in HLA-G⁺ EVTs (p = 0.04)；20 μg/mL aPLs group: Caused cystic structures transformation across five independent donors (#1-#5) with significant Ki67 downregulation by Day 9 (p < 0.05); 50 μg/mL aPLs group: Induced > 30% Ki67 suppression (p < 0.01), structural disintegration, and cell death by Day 6 (cytotoxic threshold) (Fig. 3E–H). Crucially, 20 μg/mL aPLs specifically impaired trophoblast differentiation trajectories—reducing TP63⁺/Ki67⁺ proliferative CTB; CD71⁺ STB; HLA-G⁺ EVT—demonstrating preferential disruption of CTB proliferation and their transition to EVTs (p < 0.05; Fig. 3I, J). Mechanistically, 20 μg/mL aPLs triggered redox imbalance mimicking OAPS placental pathology: significant upregulation of hypoxia-sensitive indicators (iNOS, HIF-1α, HO-1) concurrent with suppression of antioxidant mediators (NRF2, SOD2, GPX4) (p < 0.05; Fig. 3K, L); Spatial IF co-localization analysis further revealed pronounced iNOS-SOD2 co-localization within organoid peripheral cells (enriched in CTB and EVT), whereas NRF2 exhibited pan-organoid distribution with minimal interaction with HO-1 (p < 0.05; Fig. 3M, N), collectively confirming in vitro recapitulation of aPLs-mediated tissue-specific oxidative dysfunction.

FIG. 3.

Dose-dependent spatial remodeling of TOs by aPLs unveils oxidation-hypoxia circuitry. (A) Schematic timeline illustration of the long-term cultivation, differentiation, and phenotypic mimicry of aPLs-induced placental injury in TOs (The inner CTB fused to form STB, and the outermost CTB differentiates into migratory and invasive EVT). (B) Bright-field images of TOs in TOM (Day7 and 12 post-passage) and EVTM (day10 and 15). (C, D) IF images of Ki67⁺/TP63⁺ CTB (proliferative), CD71⁺ multinucleated STB, and HLA-G⁺ EVT (migratory and invasive). Yellow arrowheads indicate key structures. (E) Bright-field images of TOs’ growth in the HC and aPLs (10, 20, and 50 μg/mL) intervention groups (day3, 6, and 9 in EVTM). (F–H) IF staining and quantitative of Ki67 expression in TOs established from five donors (#1, #2, #3, #4, and #5). (I, J) IF images and quantification of CD71, HLA-G, and % positive cells (Ki67⁺/TP63⁺ proliferative CTBs) in the HC and aPLs (10, 20, and 50 μg/mL) intervention groups. (K, L) Protein expression levels of hypoxia-sensitive indicators (iNOS, HIF-1α, and HO-1) and antioxidant defense mediators (NRF2, SOD2, and GPX4) in TOs. (M, N) IF staining and quantification analysis of SOD2 alongside iNOS or NRF2 alongside HO-1 in TOs. Scale bars = 50 μm. (Data present Mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA). ANOVA, analysis of variance; CTB, cytotrophoblast; EVTM, EVT medium; STB, syncytiotrophoblast; TOs, trophoblast organoids; TOM, trophoblast organoid medium. (schematic illustrations created using BioRender).

HCQ-pre sustains trophoblast differentiation capacity in aPLs-Exposed TOs

Initial dose-response screening (0.1, 1, 10 μg/mL HCQ) identified severe organoid structural disintegration and proliferative impairment at 10 μg/mL, with no cytotoxicity observed at 0.1–1 μg/mL (Supplementary Fig. S3A-C); based on prior evidence (Liu et al., 2022), 1 μg/mL HCQ was designated as a non-cytotoxic therapeutic dose. To delineate whether HCQ exerts preventive or restorative effects on aPLs-mediated placental injury, we established HCQ-pre (prophylactic) and HCQ-post (therapeutic) regimens during TOs differentiation (Fig. 4A). HCQ-pre significantly attenuated aPLs-induced cystic degeneration in organoids, whereas HCQ-post failed to restore normal morphology (Fig. 4B). IF quantification demonstrated that both HCQ-pre and HCQ-post partially reversed aPLs-mediated suppression of Ki67 expression (p = 0.0005/0.0151 vs. OAPS). Compared to trophoblast lineage dysfunction in the OAPS group, HCQ-pre effectively rescued TP63⁺/Ki67⁺ proliferative CTB populations (20% recovery; p = 0.0021) and normalized CD71⁺ STB as well as HLA-G⁺ EVT counts to near-HC levels (p = 0.0105/0.0014). In contrast, HCQ-post failed to demonstrate statistically significant lineage rescue (p > 0.05 vs. OAPS). Notably, HCQ-pre exhibited significantly higher TP63⁺/Ki67⁺ CTB proportions and elevated HLA-G expression versus HCQ-post (p = 0.0275/0.0388; Fig. 4C–F). Collectively, these data establish that HCQ-pre confers superior efficacy through a preventive mechanism, acting prior to embryonic implantation to block aPLs-induced trophoblast injury cascades, principally manifested by restoration of CTB proliferative capacity and their potential for EVTs differentiation.

FIG. 4.

HCQ-pre sustains trophoblast differentiation capacity in aPLs-exposed TOs. (A) Schematic of HCQ administration timing effects (HCQ-pre and HCQ-post) on aPLs-induced trophoblast injury in TOs—vertical dashed lines indicate culture medium transitions (TOM → EVTM#1 → EVTM#2). (B) Bright-field images of TOs’ growth in the HC, OAPS, HCQ-pre, and HCQ-post groups (day 0, 3, 6, and 9 in EVTM). (C–F) Representative 3D deep encoding IF images and quantification of CD71, HLA-G, and % positive cells (Ki67⁺/TP63⁺ proliferative CTBs) in the four groups. Scale bars = 50 μm. (Data present mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA). HCQ-post, post-conception HCQ initiation. (schematic illustrations created using BioRender).

HCQ-pre breaks the Hypoxia-Redox-EVT dysfunction axis in aPLs-Exposed organoids

Morphological assessment of trophoblast organoids at differentiation days 15 and 18 revealed that HCQ-pre and HC generated spindle-shaped, fibroblast-like EVT with robust Matrigel invasion, whereas the OAPS group exhibited cobblestone-shaped EVT with impaired differentiation and invasion. Although HCQ-post partially improved EVT morphology, invasion capacity remained deficient (Fig. 5A). FC quantification confirmed that HCQ-pre significantly enhanced the differentiation efficiency of organoids into invasive EVT (10% increase vs. OAPS; p = 0.0157)— contrasting with HCQ-post’s non-significant effect (3% increase vs. OAPS; p > 0.05; Fig. 5B–D). Mechanistically, HCQ-pre reversed aPLs-induced redox imbalance in TOs, effectively rescuing both the upregulation of hypoxia-sensitive indicators (iNOS, HIF-1α, HO-1) and the suppression of antioxidant mediators (NRF2, SOD2, GPX4) (p < 0.05 vs. OAPS)–a statistical effect not observed with HCQ-post except for iNOS (p > 0.05 vs. OAPS). Notably, HCQ-pre exhibited significantly reduced levels of HIF-1α/HO-1 and elevated expression of SOD2/GPX4 versus HCQ-post (p < 0.05; Fig. 5E–G). Crucially, spatial IF co-localization analysis revealed that hypoxia-damaged EVT (HIF-1α⁺/HLA-G⁺ co-expression) comprised > 75% of total HLA-G⁺ EVTs in the OAPS group. HCQ-pre reduced this proportion by ∼25% (p = 0.0003 vs. OAPS), establishing a direct link between redox homeostasis restoration and functional rescue of EVTs, whereas HCQ-post exhibited no significant effect (p > 0.05 vs. OAPS). It was observed that this proportion in the HCQ-pre group is significantly lower than that in the HCQ-post group (p = 0.0132; Fig. 5H–J). These results confirm that HCQ-pre disrupts aPLs-driven hypoxic injury cascades, thereby preventing EVT lineage differentiation and invasion defects.

FIG. 5.

HCQ-pre breaks the hypoxia-redox-EVT dysfunction axis in aPLs-exposed TOs. (A) Bright-field images of EVT differentiation in TOs (day15 and 18 in EVTM). EVT streams out of the TOs, exhibiting varying capabilities for migration and invasion. (B–D) FC quantification analyses of EVTs derived from TOs. (E–G) Protein expression levels of hypoxia-sensitive indicators (iNOS, HIF-1α, and HO-1) and antioxidant defense mediators (NRF2, SOD2, and GPX4) in the HC, OAPS, HCQ-pre, and HCQ-post groups. (H–J) IF co-localization staining and quantification: hypoxia markers (HIF-1α/HO-1) alongside HLA-G; Ratio of HIF-1α⁺/HLA-G⁺-positive cells in total EVTs (HLA-G⁺). Scale bars = 50 μm. (Data present mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA). FC, flow cytometry.

Spatiotemporal activation of Wnt/β-catenin and hippo/YAP pathways underlies HCQ-pre’s rescue of trophoblast oxidative dysfunction in OAPS

Transcriptomic profiling of TOs from HC, OAPS, and HCQ-pre groups revealed that HCQ-pre effectively reverses aPLs-induced dysregulation of core trophoblast developmental programs. This reversal encompassed two functionally critical categories: (i) key signaling pathway genes governing CTB-to-EVT fate specification (e.g., WNT7A, NOTCH1), and (ii) characteristic marker genes representing major trophoblast subtypes (e.g., TP63/TFAP2A for CTB, GCM1/CGB1 for STB, HLA-G/MMP2 for EVT) (Fig. 6A; Supplementary Fig. S4A-C). To systematically quantify expression dynamics across critical trophoblast developmental transitions, we selected eight lineage-defining genes from differentially expressed genes (DEGs) based on their established roles in: (1) undifferentiated CTB maintenance (TP63, TFAP2A, TFAP2C, FGFR2, ITGA6, TEAD4, CTNNB1, ETS1), (2) STB formation/fusion (CD71, PAPPA2, CGB1, INHA, ERVFRD-1, ERVW-1, SDC1, CGA), and (3) EVT differentiation/function (HLA-G, ITGA5, CD9, MMP2, MMP15, MCAM, ITGA1, SMAD3) (Okae et al., 2018) (Fig. 6B). Critically, orthogonal quantitative real-time polymerase chain reaction (qRT-PCR)/western blot (WB) validation in TOs confirms HCQ-pre effectively reverses aPLs-impaired three pivotal regulators of core trophoblast development: notch homolog 1 (NOTCH1, master regulator of CTB-to-EVT fate specification via Notch signaling) (Sandra et al., 2013), integrin subunit alpha 5 (ITGA5, surface marker specific to early EVT differentiation), and matrix metallopeptidase 2 (MMP2, functional activity marker for invasive EVT subsets) (Supplementary Fig. S4G-I). These molecular restitution events exhibit direct concordance with prior functional phenotypic assays in vitro TOs, establishing an unambiguous mechanism-to-phenotype evidence chain for HCQ-pre’s pharmacological actions. Gene Ontology/Kyoto Encyclopaedia of Genes and Genomes (GO/KEGG) enrichment highlighted redox homeostasis (responses to hypoxia, oxidoreductase activity, and nitrite reductase/NO−forming) and Wnt/Hippo/stem cell pluripotency signaling pathways as core targets (Fig. 6C, D; Supplementary Fig. S4D-F).

FIG. 6.

Spatiotemporal activation of Wnt/β-catenin and Hippo/YAP pathways underlies HCQ-pre’s rescue of trophoblast oxidative dysfunction in OAPS. (A) Volcano plots of DEGs in TOs: OAPS vs. HC (left) | HCQ-pre vs. OAPS (right) (Significance: p < 0.05 + |log2FC|≥1.5; Key: Upregulated (red); Downregulated (blue); p < 0.05 only (yellow). (B) Labeled 8 Lineage-specific genes of CTB, STB, and EVT in the HC, OAPS, and HCQ-pre groups. (C, D) GO/KEGG enrichment analysis of DEGs among the three groups. (E, F) Protein expression levels of core signaling nodes (β-catenin/GSK-3β for Wnt; YAP/TAZ for Hippo) in TOs measured by WB. (G–I) IF co-localization staining and quantification analysis: β-catenin, YAP alongside TAZ, and β-catenin/YAP nuclear accumulation ratio (Data present Pearson’s Coefficient with DAPI) in the HC, OAPS, and HCQ-pre groups. (J–L) Protein expression levels of hypoxia-sensitive indicators (iNOS, HIF-1α, and HO-1) and antioxidant defense mediators (NRF2, SOD2, and GPX4) in rescue groups (with pathway-specific inhibitors: IN-6 for Wnt/β-catenin, Verteporfin for Hippo/YAP signaling). Scale bars = 50 μm. (Data present mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA). DEGs, differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Given validated crosstalk between HIF-1α-mediated hypoxia and Wnt/Hippo pathways in stem cell differentiation (Cui et al., 2021; Dey et al., 2020), we assessed core signaling nodes (β-catenin/glycogen synthase kinase-3 beta [GSK-3β] for Wnt; Yes-associated protein [YAP]/transcriptional coactivator with PDZ-binding motif [TAZ] for Hippo) and performed inhibitor rescue assays. HCQ-pre selectively restored the reduced expression of β-catenin and YAP in the OAPS group (p = 0.0048/0.013) without affecting GSK-3β and TAZ levels (p > 0.05). Additionally, HCQ-pre reversed both the reduced p-GSK-3β and the elevated p-YAP expression (p = 0.0003/0.0019) in the OAPS group, as further indicated by quantitative phospho-profiling (Fig. 6E, F). Spatial IF co-localization analysis revealed HCQ-pre-induced nuclear accumulation of both β-catenin and YAP (1.3-fold and 1.5-fold vs. OAPS, p = 0.0039/0.0013), with β-catenin enriched at organoid peripheries (EVT layer), which—combined with WB data—collectively confirms functional engagement of activated Wnt/β-catenin and Hippo/YAP signaling in HCQ-pre’s pharmacological mechanism (Fig. 6G–I). Specifically, HCQ-pre significantly reversed the aPLs-induced inhibitory phosphorylation of GSK-3β, thereby stabilizing β-catenin and increasing its nuclear accumulation, while simultaneously reducing activating phosphorylation of YAP to promote its nuclear accumulation. Partial reversal of HCQ-pre’s redox restoration by YAP inhibitor verteporfin and β-catenin inhibitor IN-6 indicates that HCQ-pre activates these signaling (notably in EVT lineage) to mitigate transcriptional dysregulation and oxidative damage (p < 0.05 vs. HCQ-pre; Fig. 6J–L).

HCQ-pre restores aPLs-Mediated pathological pregnancies by rebuilding placental trophoblast differentiation homeostasis in OAPS murine

To evaluate HCQ efficacy against OAPS-associated placental/developmental pathologies in vivo, we optimized OAPS murine models simulating clinical progression (Liu et al., 2022) (Fig. 7A). At embryonic day 14.5 (E14.5), HCQ-pre/HCQ-post significantly reduced embryo resorption rates versus the OAPS group (p < 0.05), whereas the HCQ-post group exhibited FGR phenotype and ectodermal defects. Crucially, HCQ-pre significantly increased both placental and fetal weights versus OAPS and normalized placental-to-fetal weight ratios to near-HC levels (p < 0.05), indicating restored developmental homeostasis, while HCQ-post showed no statistical improvement (p > 0.05 vs. OAPS; Fig. 7B–F). Longitudinal offspring assessment revealed accelerated growth trajectories in HCQ-pre progeny versus OAPS and HCQ-post groups (Fig. 7G), suggesting persistent maternal aPLs-mediated developmental effects postnatally, warranting further investigation. Histopathology confirmed severe placental defects in OAPS murine, including labyrinth zone (Lab) reduction (p = 0.0484, >20% area decrease vs. HC; Fig. 7L), stromal necrotic lesions, and vascular maladaptation (dilated intervillous spaces with collapsed sinuses), indicating chronic ischemia. HCQ-pre significantly reversed these pathologies, restoring Lab architecture and vascular density, whereas HCQ-post exhibited unrepaired necrotic lesions (Fig. 7H).

FIG. 7.

HCQ-pre restores aPLs-mediated pathological pregnancies by rebuilding placental trophoblast differentiation homeostasis in OAPS murine. (A) Schematic timeline illustrating the OAPS Murine model alongside the simulation of HCQ administration in vivo. (B) Representative uterus morphology at E14.5d in the HC, OAPS, HCQ-pre, and HCQ-post groups. (C–G) Statistical analyses among the four groups: fetal resorption ratio, fetal weight, placental weight, the ratio of placental to fetal weight (at E14.5d), and individual offspring growth curves. (H) H&E staining in different magnifications of transverse sections of mouse placentas at E14.5d, with placental structures (De/JZ/Lab) demarcated by dotted lines and pathological features indicated by arrowheads. (I) Schematic illustration of the murine placenta. (J–M) IHC staining and quantification of Ki67/CK8 expression in the murine placentas. (N, O) IF staining and quantification analysis of MCT-4 (marker of SynT) and TPBPA (marker of SpT) expression at E14.5d. Scale bars = 50 μm. (Data present mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA). CK8, cytokeratin 8; De, decidua; JZ, junctional zone; Lab, labyrinth zone; MCT-4, monocarboxylate transporter 4; SpT, spongy trophoblast cells; SynT, syncytiotrophoblast cells; TPBPA, trophoblast-specific protein alpha. (schematic illustrations created using BioRender).

Murine placental functions encompass proliferation, spongiotrophoblast (SpT) invasion, and syncytiotrophoblast (SynT) syncytialization (Fig. 7I). HCQ-pre and HCQ-post effectively rescued Ki67 expression versus OAPS (p = 0.0019/0.0444). Furthermore, HCQ-pre significantly rescued CK8⁺ invasive trophoblast populations with enhanced decidual/vascular penetration (20% increase vs. OAPS, p = 0.0268), contrasting with HCQ-post’s non-significant effect (vs. OAPS; p > 0.05; Fig. 7J–M). HCQ-pre normalized MCT-4⁺ SynT-II cells (10% increase vs. OAPS, p = 0.043) and TPBPA⁺ invasive SpT cells (30% increase vs. OAPS, p = 0.0061) to near-HC levels, whereas HCQ-post exhibited no significant lineage rescue (vs. OAPS; p > 0.05; Fig. 7N, O). These in vivo results align with TOs data, confirming HCQ-pre’s superiority in rectifying aPLs-mediated pathological pregnancies and trophoblast dysregulation.

HCQ-pre reestablishes spatiotemporal redox homeostasis to rescue placental vascular perfusion and SA remodeling in OAPS murine

HCQ-pre reversed placental redox imbalance in OAPS murine by rescuing the upregulated iNOS, HIF-1α, and HO-1 and the suppressed NRF2, SOD2, and GPX4 (p < 0.05 vs. OAPS)–an effect absents in HCQ-post (p > 0.05 vs. OAPS). Notably, HCQ-pre exhibited significantly reduced levels of iNOS/HO-1 and elevated expression of NRF2/SOD2/GPX4 versus HCQ-post (p < 0.01; Fig. 8A–C). Immunohistochemistry (IHC) spatial mapping confirmed HCQ-pre’s redox restoration, revealing co-localization of these redox indices (HIF-1α, HO-1, GPX4, SOD2) within the Lab zone (Fig. 8D–F)—the functional hub for angiogenesis, SA remodeling, and trophoblast invasion. Concomitantly, spatial IF confirmed HCQ-pre rebalances iNOS-SOD2 dysregulation (nitric oxide regulators) and enhances placental vasculature (CD31/Vimentin increase) in OAPS murine (p < 0.05 vs. OAPS), contrasting with HCQ-post’s non-significant effects except for CD31 (p > 0.05 vs. OAPS; Fig. 8G,I, J). This aligns with hypoxia-linked oxidative stress/NO synthesis disorders regulating angiogenesis (Zhao et al., 2024). At E14.5, placental fluorescein isothiocyanate (FITC)-Dextran perfusion and micro computed tomography (micro-CT) angiography revealed that HCQ-pre significantly reversed hypoperfusion, restored vascular branching complexity in OAPS murine, and increased fetoplacental vascular perfusion volume/area (p < 0.05 vs. OAPS), achieving SA remodeling comparable to HC. In contrast, HCQ-post showed non-significant improvements versus OAPS (p > 0.05; Fig. 8H and K–N). Although Doppler ultrasonography showed only partial improvement in HCQ-pre’s umbilical artery resistance indices (Fig. 8O–Q), the collective data demonstrate HCQ-pre mitigates oxidative stress-driven vascular defects, enhances placental perfusion, and thereby protects against aPLs-mediated hypoxic injury—ultimately supporting fetal development via optimized maternal-fetal circulation.

FIG. 8.

HCQ-pre reestablishes spatiotemporal redox homeostasis to rescue placental vascular perfusion and SA remodeling in OAPS murine. (A–C) Protein expression levels of hypoxia-sensitive indicators (iNOS, HIF-1α, and HO-1) and antioxidant defense mediators (NRF2, SOD2, and GPX4) in the HC, OAPS, HCQ-pre, and HCQ-post groups. (D–F) IHC staining and quantification of HIF-1α, HO-1, GPX4, and SOD2 expression in murine placentas. (G, I, J) IF staining and quantitative analysis of iNOS, SOD2 (nitric oxide regulators), CD31 (marker of vascular), and Vimentin (marker of vascular remodeling) expression. (H, K) Representative images and quantitative analysis of placental perfusion of FITC-dextran. (L–N) Representative 3D volume renderings of the casted feta-placental arterial vascular trees within the regions of SA remodeling at E14.5d, as visualized through micro-CT. Quantitative analyses of the vascular volume and area of placental perfusion. (O–Q) Doppler ultrasound imaging of placental blood flow. The colors blue and red represent the perfusion in the placental veins and arteries—quantification of hemodynamics of the umbilical artery, including PI and RI. Scale bars = 50 μm. (Data present mean ± SD; ns p ≥ 0.05. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA). FITC, fluorescein isothiocyanate; micro-CT, micro computed tomography; PI, pulpability index; SA, spiral arteries; RI, resistance index.

Discussion

HCQ demonstrates therapeutic potential in autoimmune pathological pregnancies, yet optimal administration timing and mechanistic underpinnings in OAPS remain contentious, leading to predominantly empirical clinical use. This study integrates clinical review, trophoblast organoid modeling, and in vivo validation to establish that HCQ-pre prophylactically protects trophoblast differentiation trajectories by reversing placental redox imbalance prior to embryo implantation. This intervention enhances SA remodeling and ultimately mitigates placental hypoperfusion injury in OAPS. Our findings underscore the preventive value of HCQ-pre for OAPS and provide a mechanistic rationale for optimized clinical deployment.

The rising incidence of infertility, recurrent implantation failure, and miscarriage has heightened recognition of autoimmune disorders in women of reproductive age. These patients persistently endure systemic immune-inflammatory attacks mediated by autoantibodies both preconception and throughout pregnancy, exhibiting pathophysiological processes post-conception akin to placental insufficiency—particularly manifesting as placental ischemia, oxidative stress, and inflammatory events (Somers, 2020). These pathological cascades ultimately culminate in PE, FGR, preterm birth, and spontaneous abortion (Skeith et al., 2020). As a representative autoimmune disease characterized primarily by placental insufficiency, OAPS presents either as an isolated disorder or secondary to SLE. Its marked clinical heterogeneity complicates therapeutic management, with ∼30% of refractory patients unresponsive to standard antithrombotic (aspirin/heparin) therapy regimens (Kaneko et al., 2022). Thus, elucidating the pathogenesis of placental insufficiency in OAPS and developing targeted interventions are critical for addressing the broader challenges in autoimmune pregnancy complications.

HCQ, an immunomodulator with vascular-protective properties, mitigates oxidative stress and complement activation. Initially endorsed in European Alliance of Associations for Rheumatology guidelines for SLE management during pregnancy, its application has expanded to OAPS and Sjögren’s syndrome, reflecting its enormous potential to improve perinatal outcomes in autoimmune patients (Fanouriakis et al., 2019; Hooper et al., 2023). Gerde et al.’s retrospective studies showed that adding HCQ to conventional anticoagulation raised pregnancy success rates from 69.1% to 78%, while preconception initiation elevated live birth rates from 62.5% to 97.1% and reduced aPLs-mediated complications from 37.5% to 8.7% (Gerde et al., 2021; Tian et al., 2021). These results align with ours, highlighting HCQ-pre’s clinical relevance in preventing placental insufficiency-related pathological pregnancy risks. However, HCQ’s complex chronic pharmacokinetics and unclear efficacy/mechanisms across administration timings leave current practice largely evidence-limited and empirically driven (Dernoncourt et al., 2024). Ongoing debates about HCQ timing (pre- vs. post-conception) underscore the need for large-scale randomized trials and rigorous mechanistic studies to optimize clinical protocols (Ambati et al., 2023; Tektonidou et al., 2019).

Mechanistically, HCQ modulates trophoblast biology through multiple pathways: attenuating aPLs internalization and enhancing STB differentiation via Toll-like receptors and the JAK signaling (Choi et al., 2022; Marchetti et al., 2014); bolstering antioxidant defenses while suppressing NOD-like receptor family, pyrin domain containing 3 inflammasome activation and pro-inflammatory cytokines (tumor necrosis factor-alpha, interleukin-1 beta) (Basri et al., 2024; Devarajan and Vaseghi, 2021); and restoring EVTs function via regulating the expression of vascular endothelial growth factor (VEGF)/MMP2 (Arachchillage et al., 2023; Liu et al., 2022). Trophoblast differentiation defects and oxidative damage thus represent focal points of HCQ action. However, limited access to early-gestation OAPS placental tissue and the inadequacy of 2D cultures constrain mechanistic exploration. Recent advances in 3D trophoblast organoids—which recapitulate trophoblast stem cell self-renewal and differentiation—offer a transformative model, as demonstrated by their utility in studying PE pathophysiology and drug responses (Pascual, 2022; Zhang et al., 2023).

Consequently, this study utilized trophoblast organoids to model aPLs-mediated hypoxic injury in vitro, recapitulating differentiation defects in OAPS placental samples. aPLs dose-dependently impaired CTB proliferation and their differentiation into EVTs, with higher concentrations further disrupting CTB proliferation and STB lineage differentiation. CTB depletion signifies premature loss of proliferative capacity, aligning with reports that aPLs induce aberrant CTB differentiation in early gestation (Bose et al., 2006; Hemberger et al., 2020). HCQ-pre reversed these organoid defects and potently restored EVT invasiveness, whereas HCQ-post showed limited efficacy. Organoid structural anomalies in OAPS—resembling cAMP/AKT-activated cystic phenotypes (Turco et al., 2018)—were absent in HCQ-pre groups. Since AKT signaling sustains trophoblast proliferation (Zhu et al., 2023), we propose aPLs and HCQ likely modulate differentiation through CTB proliferative capacity. Thus, HCQ-pre preserves trophoblast differentiation potential by sustaining proliferative capacity, supporting its preconception use to prevent irreversible placental damage in OAPS. These findings demonstrate HCQ’s ability to modify disease progression, while aPLs profiling may help tailor treatment timing and dosage for optimal protection. Given the concentration-dependent aPLs effects, future studies should correlate aPLs titers with placental dysfunction to pre-stratify patients with OAPS for personalized HCQ regimens.

Redox imbalance critically governs trophoblast proliferation, differentiation, and migration in placental insufficiency (Bagchi and Bagchi, 2024). Further mechanistic analysis revealed that HCQ-pre rescues trophoblast differentiation by inhibiting HIF1α-mediated hypoxia and restoring antioxidant mediators (NRF2/SOD2/GPX4). Beyond hypoxic adaptation (Zhang et al., 2021), HIF-1α/HO-1 signaling triggers pathological reactive oxygen species (ROS) accumulation, mitochondrial dysfunction, and ferroptosis—processes linked to implicated in infertility, diabetic nephropathy, and acute lung injury (Jiang et al., 2020; Shi et al., 2021; Wu et al., 2022). The dual effect exhibited by HO-1—converting heme to biliverdin while exacerbating oxidative damage via ROS (Gamage et al., 2021)—suggests tissue-specific functional heterogeneity. Trophoblast differentiation and redox balance are governed by interconnected pathways. Hypoxia sustains stem cell differentiation via HIF-1α/Wnt/β-catenin (Cui et al., 2021), while Wnt and Hippo/YAP signaling regulate EVT progenitor formation (Dietrich et al., 2022; Ray et al., 2022). Reduced YAP expression by aPLs disrupts CTB proliferation and differentiation (Huang et al., 2022; Soncin and Parast, 2020), aligning with our transcriptomic analyses suggesting HCQ-pre preserves trophoblast differentiation trajectories via Wnt/β-catenin and Hippo/YAP-mediated modulation of hypoxia response, oxidoreductase activity, and nitric oxide (NO) generation. This dual mechanism, which targets both oxidative stress and developmental signaling pathways, provides a mechanistic explanation for the clinical superiority of HCQ pre-initiation compared to HCQ post-treatment. These findings redefine HCQ’s role from a general immunomodulator to a precise regulator of placental development with dual-targeting capability, offering new strategies for managing placental insufficiency-related disorders. The demonstrated efficacy of this dual approach suggests promising directions for developing next-generation therapeutics that combine redox regulation with the activation of targeted signaling pathways.

During early pregnancy, maternal autoantibodies target trophoblasts and vasculature impair implantation and fetal development. Dysregulated differentiation of invasive trophoblasts and their mediated failure in SA remodeling underlie autoimmune placental insufficiency (D’Ippolito et al., 2023). Placental hypoxia suppresses NO synthesis via nicotinamide adenine dinucleotide phosphate hydrogen oxidase/ROS, causing vascular dysfunction (Zhao et al., 2024). HCQ counteracts aPLs-induced thrombosis by enhancing endothelial function through improved NO synthase coupling and reduced oxidative stress (Urbanski et al., 2018). The vascular network within the placental Lab zone facilitates maternofetal nutrient exchange and harbors vasoprotective NO regulators (iNOS/SOD2). Using an optimized OAPS murine model, we further confirmed in vivo the differential efficacy of HCQ-pre versus HCQ-post in alleviating pathological pregnancy and trophoblast differentiation defects. Notably, HCQ-pre significantly restored redox homeostasis in the OAPS placental Lab zone, thereby enhancing SA remodeling and preventing hypoperfusion-induced hypoxic injury. Bertolaccini et al. (2016) indicated that HCQ’s suppression of complement-mediated placental insufficiency and fetal neurodevelopmental defects, aligning with our observation that HCQ-pre substantially improved fetal growth and prevented ectodermal anomalies, supports its prophylactic value in OAPS. Collectively, in vivo evidence corroborates in vitro findings, indicating HCQ-pre may prevent placental insufficiency-related complications and improve fetal outcomes by restoring redox homeostasis to preserve trophoblast lineage differentiation while enhancing SA remodeling and placental perfusion. Given the unmet need for preventive strategies against autoimmune placental dysfunction, this study provides crucial clinical insights for optimizing obstetric HCQ administration.

The pathogenesis of OAPS involves multifaceted mechanisms. While our clinical and mechanistic data provide preliminary support for HCQ-pre in OAPS prevention, future studies must more fully delineate anti-β2 glycoprotein I (anti-β2GPI) antibodies’ complex pathogenicity and their synergy with other autoantibodies. Moreover, large-scale prospective trials are needed to establish optimal HCQ dosing, duration, and potential offspring effects. Trophoblast organoids advanced our understanding of HCQ’s actions but cannot fully replicate placental complexity, lacking endothelial and immune components. Future work will develop placenta-on-a-chip models with integrated vascular/immune cells to refine co-culture systems, combined with multi-omics approaches like single-cell sequencing for comprehensive pharmacological mechanism exploration. Collectively, this multidimensional investigation—spanning redox stress, trophoblast dysfunction, and vascular pathology—establishes HCQ-pre as a preventive strategy for OAPS. We emphasize preconception initiation as essential for stratified management to optimize pregnancy outcomes.

Materials and Methods

Human samples

This study received approval from the Biomedical Research Ethics Committee of Shandong Provincial Hospital Affiliated to Shandong First Medical University (No. NSFC2023-201) and complied with the Declaration of Helsinki guidelines. Written informed consent was obtained from all participants. We retrospectively analyzed 87 patients with OAPS on standard antithrombotic therapy (aspirin/heparin) at our institution (June 2022–June 2024), stratified by HCQ (200 mg/day) initiation timing—29 untreated (HCQ-non), 31 preconception-initiated (HCQ-pre), and 27 postconception-initiated (HCQ-post)—alongside 30 HCs. In our hospital’s laboratory, aPLs titers were measured using Euroimmun enzyme-linked immunosorbent assay (ELISA) kits (Germany; reference range: 0–20 CU) for anti-β2GPI and anti-cardiolipin antibodies (aCL), alongside lupus anticoagulant (LA) detection via Siemens LA1/LA2 reagents (Germany; reference range: 0.92–1.20). HCs were selected for negative aPL status, absence of pregnancy complications, and ≥ 1 healthy pregnancy. All patients with OAPS met the revised Sydney antiphospholipid syndrome (APS) criteria with high medication compliance. Exclusion criteria encompassed thrombotic APS, acute/chronic infections, other autoimmune disorders (e.g., SLE, connective tissue diseases, Sjögren’s syndrome), or malignancies (Miyakis et al., 2006).

Preparation of anti-β2GP1 antibodies

The OAPS pathological model utilized monoclonal anti-β2GPI antibodies prepared per established protocols. Supplementary Figure S1 provides a detailed overview of the antibody preparation process: The GRTCPKPDDLPF polypeptide was synthesized, conjugated to immunogen, and administered via tail vein injection in Balb/c mice. After four booster immunizations, splenocytes were fused with SP20 cells. Hybridomas were screened by ELISA to establish monoclonal lines, then inoculated into mouse peritoneal cavities for ascites production. Antibodies were purified (with Affinity Biosciences). The monoclonal antibodies exhibited comparable biological activity to patient-derived aPL-IgG antibodies (purified from OAPS serum via G-Sepharose protein chromatography) across multiple validation parameters. Through comprehensive in vitro and in vivo assessments, including ELISA, pathogenic dose–response curves, trophoblast dysfunction induction, and placental injury modeling in murine, both antibody types demonstrated consistent pathogenic effects with reproducible disease phenotype generation. This validation confirms their consistency, reproducibility, and interchangeable utility for OAPS modeling while maintaining the experimental advantages of monoclonal antibody standardization (Liu et al., 2022; Qingfeng et al., 2023).

Culture of human trophoblast organoids

Five distinct batches of human TO models were established from first-trimester placental villi (6–9 weeks of gestation) obtained from five independent healthy women donors (#1-#5, 25–35 years) using the Turco protocol (Sheridan et al., 2020), with each batch maintained across multiple culture wells to permit technical replication. Five donors underwent voluntary surgical termination after providing written informed consent, with ethical approval (NSFC2023-201). Villi were immediately rinsed in ice-cold DMEM-F12 (Gibco) with 1× penicillin/streptomycin (P/S), transferred within 3 h to decontamination medium [Ham’s F12 (Gibco) with 1×P/S], and dissected from chorionic plates using sterile blades. Following enzymatic digestion with Trypsin (#P10-025025P), cell suspensions were sequentially digested with prewarmed 0.2% trypsin/0.02% EDTA and collagenase V (#C9263), resuspended in ice-cold Matrigel (Corning #356231), and plated as 25 µL droplets in 48-well plates. Cultures were maintained in TOM medium at 37°C/5% CO₂ with medium renewal every 2–3 days. Dense TO clusters formed within 7–10 days and were passaged at 100–150 µm diameter (1:2–1:4 split ratio). TOM medium: Advanced DMEM/F12 (Gibco #12634010) supplemented with 1×P/S, 2 mM L-glutamine (#G6392), 1.25 mM N-acetyl-L-cysteine (#A9165), 1×N2 (#17502048), 1.5 µM CHIR99021 (#HY-10182), 1×B27 (vitamin A; #12587010), 500 nM A83-01 (#HY-10432), 2.5 µM PGE2 (#HY-101952), 2 µM Y-27632 (#HY-10071), Primocin (100 μg/mL), R-spondin-1 (80 ng/mL), EGF (50 ng/mL), HGF (50 ng/mL), FGF-2 (100 ng/mL).

Using trophoblast organoids derived from five independent donors (batches #1-#5), we systematically established four experimental groups: HC, OAPS, HCQ-pre, and HCQ-post. For each donor-derived batch, organoids were divided across all four treatment groups, with multiple wells maintained per condition to ensure technical replicates. Crucially, when referencing “n = 3/group” for subsequent RNA-seq/WB/IF/FC analyses in different groups (HC, OAPS, HCQ-pre, HCQ-post), this signifies that we randomly selected three donor batches of TO per group from the total five available, each batch constituting an independent biological replicate. This design ensured that each biological replicate originated from an independent placental source while maintaining balanced representation across all five donor batches in the complete experimental series.

Differentiation of human TOs

The TOs (resembling CTB structures and capable of differentiating into STB/EVT) were directly replated in Matrigel droplets into ibidi μ-dishes (Thermo, #81156) for IF staining/imaging. After 3 days in TOM medium, TOs were transferred to EVTM#1 for 6–12 days until EVT outgrowth emergence. Subsequent culture in EVTM#2 (EVTM#1 without NRG1; CST, #26941) for 5–7 days completed EVT differentiation. All medium (TOM, EVTM#1, EVTM#2) were refreshed every 3 days. EVTM#1 medium: Advanced DMEM/F12 supplemented with 1×P/S, 0.3% BSA, 2 mM L-glutamine, 0.1 mM 2-mercaptoethanol (Gibco, #21985023), 7.5 µM A83-01, NRG1 (100 ng/mL), 1% ITS-X (#51500056), and 4% knockout serum (Gibco, #10828010).

Immunofluorescence (IF) staining of TOs

IF staining of TOs was performed in ibidi μ-dishes (Thermo #81156), optimized for confocal imaging to maintain structural integrity. TOs were washed with ice-cold PBS at 4°C for 1 h, and fixed with 4% paraformaldehyde (PFA) for 45 min. After permeabilization in phosphate buffer saline (PBS)/0.1% Tween-100 and organoid washing buffer (PBS/2% bovine serum albumin [BSA]/0.1% Triton X-100) for 30 min, samples were incubated with primary antibodies overnight at 4°C. Following three 2-h washes, secondary antibodies were applied overnight alongside F-actin (#mx4403) and DAPI staining. Stained TOs were resuspended in fructose-glycerol solution and imaged on a Zeiss Cell Discoverer 7 confocal microscope. Quantitative analysis employed ImageJ software with a uniform auto-thresholding algorithm to calculate area fraction for positive cell percentage or intensity per unit area. F-actin intensity served as an internal normalization control (n = 5/group).

Flow cytometry (FC) and ELISA

Trophoblast organoid-derived EVTs were washed with ice-cold PBS and shaken at 4°C for 1 h. We dissociated cells using pre-warmed StemPro Accutase (Gibco, #A1110501) with 0.5 mg/mL collagenase V (Sigma, #C9263), then filtered suspensions through 40-µm strainers into Falcon tubes to remove debris. After blocking in ice-cold cell staining buffer (1% fetal bovine serum [FBS]/PBS) supplemented with human IgG (Sigma, #I4506) for 15 min, cells were stained with monoclonal antibodies against HLA-ABC (W6/32 clone, Biolegend, #311415) and HLA-G (MEMG-9 clone, BioLegend, #335905) for 45 min at 4°C. FC analysis used a Cytek Aurora, with digital compensation in FlowJo v10.8. For human chorionic gonadotropin (hCG) secretion, centrifuged organoid supernatants (300×g, 10 min) were aliquoted and stored at −80°C. Thawed samples underwent twofold dilution before quantification by ELISA (MULTI SCIENCES, #EK1299-48) per manufacturer instructions.

RNA-seq analysis

RNA-seq data are available in the Genome Sequence Archive (GSA) repository (accession number: HRA012094). Two biologically independent organoid batches (corresponding to distinct placental donors) were randomly selected per group for RNA-seq profiling, with each sequenced sample representing a pool of organoids from ≥ 3 culture wells to minimize technical noise (n = 2). Total RNA was extracted from trophoblast organoids using TRIzol (#AG21102) per manufacturer’s protocol (n = 2/group). RNA quality and concentration were assessed with a Nano Photometer (Thermo Fisher) and Agilent 2100 RNA Nano 6000 Assay Kit. mRNA was reverse-transcribed from oligo-attached magnetic beads using random primers for cDNA synthesis. Target fragments were isolated by magnetic bead selection, PCR-amplified for library construction, and quantified with Qubit 3.0. Library insert size was verified using Bioanalyzer 2100 (Agilent). Qualified libraries were sequenced on the Illumina NovaSeq 6000 platform. Raw reads were filtered to remove low-quality and adapter-contaminated sequences, yielding clean reads. HISAT2 (improved BWT algorithm) aligned clean reads to the GRCh38.p12 human reference genome. Gene expression was quantified as FPKM. Differential expression analysis with DEGseq2 (v1.36.0) identified DEGs (p < 0.05), followed by functional enrichment analysis using GO and KEGG databases. The qRT-PCR amplification was performed using the SYBR Green qPCR Kit (Cat# AG11701) on LightCycler 480 II (NOTCH1-F: GAGGCGTGGCAGAC-TATGC, NOTCH1-R: CTTGTACTCCGTCAGCGTGA; ITGA5-F: GGCTTCAACT-TAGACGCGGAG, ITGA5-R: TGGCTGGTATTAGCCTTGGGT; MMP2-F: CCC-ACTGCGGTTTTCTCGAAT, MMP2-R: CAAAGGGGTATCCATCGCCAT).

Animal experiments

Animal experiments were approved by the Biomedical Research Ethics Committee of Shandong First Medical University Affiliated Provincial Hospital (No. NSFC 2023–201). Female C57BL/6J mice (6–8 weeks old, Weitong Lihua, Beijing) were acclimated for 10 days under specific pathogen-free conditions (22 ± 2°C, 50–60% humidity, 14 h/10h light/dark cycle) before randomization into four groups: HC, OAPS, HCQ-pre, and HCQ-post. To clinically mirror the elevated aPLs levels observed in patients with OAPS preconception, we refined our established OAPS murine model (Liu et al., 2022). Murine received 100 μg aPLs via tail vein injection 7 days before mating with untreated males (1:2 male/female ratio), consistent with validated protocols (Geoffrey et al., 2018). Gestational timing (E0.5d) was confirmed by vaginal plug detection, with aPLs maintenance doses administered on E0.5d and E7.5d).

HCQ in saline was administered at a clinically equivalent dose of 6.5 mg/kg/day, referencing the maximum human dose of 400 mg/day for a 60-kg patient. Considering the significant pharmacokinetic differences between humans and rodents—shorter half-lives (oral t1/2 = 21.14 ± 10.31 h; IV t1/2 = 12.7 ± 1.1 h) and higher clearance rates in rodents versus complex chronic human pharmacokinetics (40 to 60 days)—we select a treatment plan for the OAPS murine model, where the HCQ-pre group received continuous HCQ starting one week preconception and continuing through E3.5d to E9.5d, while the HCQ-post group received HCQ through E3.5d to E9.5d (Lili et al., 2022; Yashpal et al., 2017). The HC group was administered physiological saline as control. Per American Veterinary Medical Association Guidelines (2020), dams were humanely euthanized by cervical dislocation at E14.5d. Pregnancy outcomes including embryonic resorption rates, fetal weights, and placental weights were systematically recorded (n = 3 dams/group).

Hematoxylin and eosin (H&E) and immunohistochemistry staining of paraffin sections

Paraffin sections were deparaffinized, rehydrated, and subjected to H&E staining to assess structural integrity. For IHC, antigen retrieval was performed by microwave-boiling in EDTA buffer (pH 8.0) for 10 min. After cooling to room temperature, endogenous peroxidase was blocked with 3% H₂O₂, followed by 40-min blocking with 5% BSA in PBS. Sections were incubated with primary antibodies overnight at 4°C, then with biotinylated secondary antibodies for 2 h at room temperature. Antibody binding was visualized using DAB substrate (PV-6000D, ZSGB-BIO) per manufacturer’s protocol. Finally, sections were counterstained with hematoxylin, dehydrated, mounted in xylene-based medium, and imaged using a VS200 slide scanner. Blinded slide scanning and analysis were conducted as follows: Technicians coded all slides and performed scans while masked to experimental groups using standardized instrument settings (laser power/gain/exposure optimized per antibody and maintained uniformly across all samples); Systematic image acquisition comprised two biological replicates per group, with three random non-overlapping 20×fields captured per slide section (n = 6 fields/group); Quantitative analysis employed ImageJ software with a uniform auto-thresholding algorithm to calculate area fraction for positive cell percentage or intensity per unit area.

IF staining of paraffin sections

Paraffin sections were deparaffinized, rehydrated, and underwent antigen retrieval in 10 mM citrate buffer (pH 6.0; microwave, 30 min). After permeabilization with 5% Triton X-100 (10 min) and blocking with 5% BSA/PBS, sections were incubated with primary antibodies at 4°C overnight. Following secondary antibody incubation (37°C, 1.5 h), nuclei were counterstained with DAPI. Fluorescence imaging was performed using a VS200 slide scanner. Positive cell percentage or fluorescence intensity per unit area was quantified with ImageJ under standardized illumination as previously described. The Pearson’s Coefficient and Overlap Coefficient assess intensity distribution correlation and fluorescence co-localization validity (n = 6 fields/group).

Placental perfusion of FITC-dextran in murine

Mice received intravenous tail vein injection of 100 µL FITC-Dextran solution (25 mg/mL, #F70109) at E14.5. After 15 min, mice were euthanized by cervical dislocation and placentas harvested (n = 3/group). Tissues were embedded in OCT compound and sectioned at 5 µm thickness using a CryoStar NX70 cryostat (−25°C). Fluorescence imaging was performed on a VS200 slide scanner (488 nm excitation), with ImageJ quantifying fluorescence intensity under standardized illumination.

Vascular casting of the fetoplacental vasculature and micro-CT tomography

Fetoplacental vascular casting was performed via umbilical artery cannulation (Tran et al., 2021). Pregnant mice at E14.5 were anesthetized with 1.5–2% isoflurane (#R510-22–10). The uterus was excised, preserving fetoplacental vasculature, with fetuses transferred to preheated saline to restore cardiac function and placental flow. Vasculature was cleared by umbilical perfusion of saline containing 2% xylocaine and 100 IU/mL heparin, followed by Microfil polymer (Flow Tech) infusion until capillary bed visualization (bright blue). Umbilical vessels were clamped, and placentas fixed in 10% buffered formalin (48 h, 4°C). Samples were embedded in 1% agar, scanned on Quantum GX2 Micro-CT (90 kV, 88 μA; 360° rotation, 512 views), and reconstructed at 7.2-µm resolution for arterial tree area/volume quantification. Three-dimensional renderings assessed placental perfusion and SA remodeling. Placentas with incomplete perfusion were excluded (n = 3/group).

Doppler ultrasound imaging of the umbilical cord and placenta in murine

Pregnant murine were anesthetized with 1.5–2% isoflurane (#R510-22–10) in a transparent chamber until unconscious at E14.5. They were secured on a 37°C heating platform, followed by abdominal depilation and ultrasound gel application. Placental blood flow was quantified using a high-resolution ultrasound system (SiliconWave30). Following B-mode localization, pulpability index (PI) and resistance index (RI) were measured via color doppler and pulse-wave (PW) modes. Experimental values represent the mean of three consecutive PW measurements (n = 3/group).

WB analyses

Protein extraction and western blotting were performed on trophoblast organoids and placental tissues. Protein lysates were normalized using a BCA Kit (Solarbio) for consistent concentration, resolved on 7.5–10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels (Epizyme; 120 V, 70 min), and transferred to polyvinylidene fluoride membranes (Millipore). Membranes were blocked with 5% skim milk (1 h, RT), incubated with primary antibodies at 4°C overnight, then with corresponding secondary antibodies (1 h, room temperaturert [RT]). Signals were detected using an Amersham Imager 600 (GE) and quantified via ImageJ.

Statistical analysis

Statistical analyses used SPSS 26.0, GraphPad Prism 9.0.0, and G*Power 3.1.9.7. Continuous variables were analyzed using unpaired Student’s t-tests or One-way ANOVA (after verifying normality and equal variance) or Mann–Whitney U tests (non-normal/distributed data), expressed as mean ± SD/M (p25, p75). Categorical variables underwent χ² tests and are presented as n (%). Significance levels were set at ns p > 0.05, *p < 0.05, **p < 0.01, and ***p < 0.001.

Electronic laboratory notebook

Electronic laboratory notebook was not used.

Authors’ Contributions

Y.C.: Writing—review and editing, writing—original draft, visualization, validation, methodology, formal analysis, data curation. M.S.: Visualization, validation, methodology, formal analysis. Q.L.: Investigation. H.L.: Conceptualization. Y.W.: Investigation. W.Q.: Validation. D.J.: Supervision. Y.X.: Writing—review and editing, funding acquisition, project administration, resources. X.W.: Writing—review and editing, supervision, project administration, funding acquisition, conceptualization.

Footnotes

Acknowledgments

The authors gratefully acknowledge the patients for their willingness to aid in the collection of placental villi tissue necessary for this research. Schematic representations were created in Adobe Illustrator (©BioRender-biorender.com) under the academic license of BioRender.

Author Disclosure Statement

The authors declare no conflict of interest.

Funding Information

This study was supported by the National Natural Science Foundation of China (Grant No. 82371694 and 82171665).

Data Availability Statement

The data that underpin the findings of this research are thoroughly detailed in both the article and the . The RNA-seq datasets are accessible in the GSA repository, identified by the accession number HRA012094.

Ethics Approval

All clinical data and human placental tissue involved in this study were anonymously signed with informed consent and approved by the Biomedical Research Ethics Committee of Shandong First Medical University Affiliated Provincial Hospital (No. 2023-201). Animal protocols adhered to ARRIVE guidelines and were approved by the Animal Care Committee of Shandong First Medical University Affiliated Provincial Hospital (No. 2023-201).

Supplemental Material

Abbreviations

References

Alijotas-Reig

, Ferrer-Oliveras

, Ruffatti

, et al.; (EUROAPS Study Group Collaborators). The European registry on obstetric antiphospholipid syndrome (EUROAPS): A survey of 247 consecutive cases. Autoimmun Rev, 2015; 14(5):387–395; doi: 10.1016/j.autrev.2014.12.010

Ambati

, Knight

, Zuo

. Antiphospholipid syndrome management: A 2023 update and practical algorithm-based approach. Curr Opin Rheumatol, 2023; 35(3):149–160; doi: 10.1097/BOR.0000000000000932

Arachchillage

, Laffan

, Pericleous

. Hydroxychloroquine as an immunomodulatory and antithrombotic treatment in antiphospholipid syndrome. Int J Mol Sci, 2023; 24(2):1331; doi: 10.3390/ijms24021331

Bagchi

, Bagchi

. Maternal-fetal mechanisms underlying adaptation to hypoxia during early pregnancy. Trends Endocrinol Metab, 2024; 35(12):1091–1099; doi: 10.1016/j.tem.2024.07.006

Basri

, Murthi

, Abd Rahman

. Hydroxychloroquine as an adjunct therapy for diabetes in pregnancy. Int J Mol Sci, 2024; 25(17):9681; doi: 10.3390/ijms25179681

Bertolaccini

, Contento

, Lennen

, et al. Complement inhibition by hydroxychloroquine prevents placental and fetal brain abnormalities in antiphospholipid syndrome. J Autoimmun, 2016; 75:30–38; doi: 10.1016/j.jaut.2016.04.008

Bose

, Kadyrov

, Goldin

, et al. Aberrations of early trophoblast differentiation predispose to pregnancy failure: Lessons from the anti-phospholipid syndrome. Placenta, 2006; 27(8):869–875; doi: 10.1016/j.placenta.2005.09.007

Choi

, Byun

, Hwang

, et al. Effect of hydroxychloroquine and chloroquine on syncytial differentiation and autophagy in primary human trophoblasts. Biomed Pharmacother, 2022; 149:112916; doi: 10.1016/j.biopha.2022.112916

Cui

, Zhang

, Yuan

, et al. HIF-1alpha affects the neural stem cell differentiation of human induced pluripotent stem cells via MFN2-mediated Wnt/beta-catenin signaling. Front Cell Dev Biol, 2021; 9:671704; doi: 10.3389/fcell.2021.671704

10.

D’Ippolito

, Barbaro

, Paciullo

, et al. Antiphospholipid syndrome in pregnancy: New and old pathogenetic mechanisms. Int J Mol Sci, 2023; 24(4):3195; doi: 10.3390/ijms24043195

11.

Dernoncourt

, Hedhli

, Abisror

, et al. Hydroxychloroquine in recurrent pregnancy loss: Data from a French prospective multicenter registry. Hum Reprod, 2024; 39(9):1934–1941; doi: 10.1093/humrep/deae146

12.

Devarajan

, Vaseghi

. Hydroxychloroquine can potentially interfere with immune function in COVID-19 patients: Mechanisms and insights. Redox Biol, 2021; 38(0):101810; doi: 10.1016/j.redox.2020.101810

13.

Dey

, Varelas

, Guan

. Targeting the hippo pathway in cancer, fibrosis, wound healing and regenerative medicine. Nat Rev Drug Discov, 2020; 19(7):480–494; doi: 10.1038/s41573-020-0070-z

14.

Dietrich

, Haider

, Meinhardt

, et al. WNT and NOTCH signaling in human trophoblast development and differentiation. Cell Mol Life Sci, 2022; 79(6):292; doi: 10.1007/s00018-022-04285-3

15.

Fanouriakis

, Kostopoulou

, Alunno

, et al. 2019 update of the EULAR recommendations for the management of systemic lupus erythematosus. Ann Rheum Dis, 2019; 78(6):736–745; doi: 10.1136/annrheumdis-2019-215089

16.

Gamage

SMK

, Lee

KTW

, Dissabandara

DLO

et al. Dual role of heme iron in cancer; promotor of carcinogenesis and an inducer of tumour suppression. Exp Mol Pathol, 2021; 120:104642; doi: 10.1016/j.yexmp.2021.104642

17.

Geoffrey

, Antoine

, Caroline

, et al. Hydroxychloroquine partially prevents endothelial dysfunction induced by anti-beta-2-GPI antibodies in an in vivo mouse model of antiphospholipid syndrome. PLoS One, 2018; 13(11); doi: 10.1371/journal.pone.0206814

18.

Gerde

, Ibarra

, Mac Kenzie

, et al. The impact of hydroxychloroquine on obstetric outcomes in refractory obstetric antiphospholipid syndrome. Thromb Res, 2021; 206:104–110; doi: 10.1016/j.thromres.2021.08.004

19.

Hemberger

, Hanna

, Dean

. Mechanisms of early placental development in mouse and humans. Nat Rev Genet, 2020; 21(1):27–43; doi: 10.1038/s41576-019-0169-4

20.

Hooper

, Bacal

, Bedaiwy

. Does adding hydroxychloroquine to empiric treatment improve the live birth rate in refractory obstetrical antiphospholipid syndrome? A systematic review. Am J Reprod Immunol, 2023; 90(3):e13761; doi: 10.1111/aji.13761

21.

Huang

, Tang

, Guan

, et al. Inactivation of yes-associated protein mediates trophoblast dysfunction: A new mechanism of pregnancy loss associated with anti-phospholipid antibodies? Biomedicines, 2022; 10(12):3296; doi: 10.3390/biomedicines10123296

22.

Huo

, Sun

, Lv

, et al. Simvastatin ameliorates adverse pregnancy by inhibiting glycolysis-related NETs in obstetrical antiphospholipid syndrome. Life Sci, 2024; 359(0):123215; doi: 10.1016/j.lfs.2024.123215

23.

Jiang

, Zhao

, Han

, et al. HIF-1alpha ameliorates tubular injury in diabetic nephropathy via HO-1-mediated control of mitochondrial dynamics. Cell Prolif, 2020; 53(11):e12909; doi: 10.1111/cpr.12909

24.

Kaneko

, Ozawa

, Murashima

. Obstetric anti-phospholipid syndrome: From pathogenesis to treatment. Immunol Med, 2022; 45(2):79–93; doi: 10.1080/25785826.2021.1969116

25.

Lili

, Zhipeng

, Shi

, et al. LC-MS/MS method for determination of hydroxychloroquine and metabolites: Application in a pharmacokinetic study. J Anal Methods Chem, 2022; 2022(0); doi: 10.1155/2022/6058445

26.

Liu

, Zhang

, Tian

, et al. Protection by hydroxychloroquine prevents placental injury in obstetric antiphospholipid syndrome. J Cell Mol Med, 2022; 26(15):4357–4370; doi: 10.1111/jcmm.17459

27.

Marchetti

, Ruffatti

, Wuillemin

, et al. Hydroxychloroquine restores trophoblast fusion affected by antiphospholipid antibodies. J Thromb Haemost, 2014; 12(6):910–920; doi: 10.1111/jth.12570

28.

McCarthy

, Wenceslau

, Goulopoulou

, et al. Autoimmune therapeutic chloroquine lowers blood pressure and improves endothelial function in spontaneously hypertensive rats. Pharmacol Res, 2016; 113(Pt A):384–394; doi: 10.1016/j.phrs.2016.09.008

29.

Miyakis

, Lockshin

, Atsumi

, et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost, 2006; 4(2):295–306; doi: 10.1111/j.1538-7836.2006.01753.x

30.

Okae

, Toh

, Sato

, et al. Derivation of human trophoblast stem cells. Cell Stem Cell, 2018; 22(1):50–63.e56; doi: 10.1016/j.stem.2017.11.004

31.

Pascual

. Trophoblast organoids: A new tool for studying placental development. Environ Health Perspect, 2022; 130(5):54003; doi: 10.1289/EHP11351

32.

Qingfeng

, Yuan

, Wei

, et al. Exosomal miR-146a-5p derived from human umbilical cord mesenchymal stem cells can alleviate antiphospholipid antibody-induced trophoblast injury and placental dysfunction by regulating the TRAF6/NF-κB axis. J Nanobiotechnology, 2023; 21(1); doi: 10.1186/s12951-023-02179-5

33.

Ray

, Saha

, Ghosh

, et al. Hippo signaling cofactor, WWTR1, at the crossroads of human trophoblast progenitor self-renewal and differentiation. Proc Natl Acad Sci U S A, 2022; 119(36):e2204069119; doi: 10.1073/pnas.2204069119

34.

Sandra

, Gudrun

, Philipp

, et al. Notch signaling plays a critical role in motility and differentiation of human first-trimester cytotrophoblasts. Endocrinology, 2013; 155(1); doi: 10.1210/en.2013-1455

35.

Sciascia

, Hunt

, Talavera-Garcia

, et al. The impact of hydroxychloroquine treatment on pregnancy outcome in women with antiphospholipid antibodies. Am J Obstet Gynecol, 2016; 214(2):273.e1–273.e8; doi: 10.1016/j.ajog.2015.09.078

36.

Sheridan

, Fernando

, Gardner

, et al. Establishment and differentiation of long-term trophoblast organoid cultures from the human placenta. Nat Protoc, 2020; 15(10):3441–3463; doi: 10.1038/s41596-020-0381-x

37.

Shi

, Yu

, Song

, et al. Dexmedetomidine ameliorates endotoxin-induced acute lung injury in vivo and in vitro by preserving mitochondrial dynamic equilibrium through the HIF-1a/HO-1 signaling pathway. Redox Biol, 2021; 41:101954; doi: 10.1016/j.redox.2021.101954

38.

Skeith

, Blondon

, Ni

. Understanding and preventing placenta-mediated pregnancy complications. Hamostaseologie, 2020; 40(3):356–363; doi: 10.1055/a-1184-8388

39.

Somers

. Pregnancy and autoimmune diseases. Best Pract Res Clin Obstet Gynaecol, 2020; 64:3–10; doi: 10.1016/j.bpobgyn.2019.11.004

40.

Soncin

, Parast

. Role of hippo signaling pathway in early placental development. Proc Natl Acad Sci U S A, 2020; 117(34):20354–20356; doi: 10.1073/pnas.2013559117

41.

Tektonidou

, Andreoli

, Limper

, et al. EULAR recommendations for the management of antiphospholipid syndrome in adults. Ann Rheum Dis, 2019; 78(10):1296–1304; doi: 10.1136/annrheumdis-2019-215213

42.

Tian

, Xu

, Chen

, et al. The additional use of hydroxychloroquine can improve the live birth rate in pregnant women with persistent positive antiphospholipid antibodies: A systematic review and meta-analysis. J Gynecol Obstet Hum Reprod, 2021; 50(8):102121; doi: 10.1016/j.jogoh.2021.102121

43.

Tran

, Weckman

, Crowley

, et al. The Angiopoietin-Tie2 axis contributes to placental vascular disruption and adverse birth outcomes in malaria in pregnancy. EBioMedicine, 2021; 73(0):103683; doi: 10.1016/j.ebiom.2021.103683

44.

Turco

, Gardner

, Kay

, et al. Trophoblast organoids as a model for maternal-fetal interactions during human placentation. Nature, 2018; 564(7735):263–267; doi: 10.1038/s41586-018-0753-3

45.

Urbanski

, Caillon

, Poli

46.

Vornic

, Nesiu

, Ardelean

, et al. Antioxidant defenses, oxidative stress responses, and apoptosis modulation in spontaneous abortion: An immunohistochemistry analysis of first-trimester chorionic villi. Life (Basel), 2024; 14(9):1074; doi: 10.3390/life14091074

47.

, Wang

, Zhao

, et al. Di-(2-ethylhexyl) phthalate exposure leads to ferroptosis via the HIF-1alpha/HO-1 signaling pathway in mouse testes. J Hazard Mater, 2022; 426:127807; doi: 10.1016/j.jhazmat.2021.127807

48.

Yang

, Jiang

, Tang

, et al. Assessment of the 2023 ACR/EULAR antiphospholipid syndrome classification criteria in a Chinese cohort: Impact on clinical practice. J Autoimmun, 2024; 146:103237; doi: 10.1016/j.jaut.2024.103237

49.

Yashpal

, Richard

, Jing

, et al. Simultaneous quantitation of hydroxychloroquine and its metabolites in mouse blood and tissues using LC-ESI-MS/MS: An application for pharmacokinetic studies. J Chromatogr B Analyt Technol Biomed Life Sci, 2017; 1072(0); doi: 10.1016/j.jchromb.2017.11.026

50.

Yoo-Min

, Ji-Hee

, Hyun-Hwa

, et al. Hydroxychloroquine in obstetrics: Potential implications of the prophylactic use of hydroxychloroquine for placental insufficiency during pregnancy. Obstet Gynecol Sci, 2024; 67(2); doi: 10.5468/ogs.23252

51.

, Yang

, Ding

, et al. Effects of serum from patients with early-onset pre-eclampsia, HELLP syndrome, and antiphospholipid syndrome on fatty acid oxidation in trophoblast cells. Arch Gynecol Obstet, 2015; 292(3):559–567; doi: 10.1007/s00404-015-3669-2

52.

Zhang

, He

, Cui

, et al. Regulatory effects of HIF-1alpha and HO-1 in hypoxia-induced proliferation of pulmonary arterial smooth muscle cells in yak. Cell Signal, 2021; 87:110140; doi: 10.1016/j.cellsig.2021.110140

53.

Zhang

, Lee

, Yang

, et al. Adrenomedullin has a pivotal role in trophoblast differentiation: A promising nanotechnology-based therapeutic target for early-onset preeclampsia. Sci Adv, 2023; 9(44):eadi4777; doi: 10.1126/sciadv.adi4777

54.

Zhao

, Lei

, Deng

, et al. Gestational hypoxia impaired endothelial nitric oxide synthesis via miR-155-5p/NADPH oxidase/reactive oxygen species axis in male offspring vessels. J Am Heart Assoc, 2024; 13(3):e032079; doi: 10.1161/JAHA.123.032079

55.

Zhu

, Wu

, Hu

, et al. LDHA deficiency inhibits trophoblast proliferation via the PI3K/AKT/FOXO1/CyclinD1 signaling pathway in unexplained recurrent spontaneous abortion. Faseb J, 2023; 37(2):e22744; doi: 10.1096/fj.202201219RR

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

4.53 MB