Epitranscriptomic Control of Vascular Smooth Muscle Cell Ferroptosis by WTAP in the Pathogenesis of Vascular Restenosis

Abstract

Aims:

Vascular restenosis is a common complication following vascular interventions, driven by abnormal proliferation and phenotypic switching of vascular smooth muscle cells (VSMCs). Ferroptosis, an iron-dependent regulated cell death, has been implicated in VSMC dysfunction and vascular remodeling. However, the epitranscriptomic regulation of ferroptosis in VSMCs remains unclear.

This study investigates the role of Wilms tumor suppressor gene WT1-associated protein (WTAP), a key N6-methyladenosine (m6A) RNA methylation regulator, in controlling ferroptosis of VSMCs during vascular restenosis.

Results:

A balloon injury rat model and platelet-derived growth factor-BB-stimulated VSMCs were used to mimic vascular restenosis. WTAP expression and global m6A levels were assessed. Functional assays evaluated the effects of WTAP overexpression on ferroptosis markers, reactive oxygen species (ROS), lipid peroxidation, and VSMC proliferation. Mechanistic studies explored WTAP-mediated m6A modification of the long non-coding RNA growth arrest specific 5 (GAS5), its interaction with enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), and downstream regulation of interferon regulatory factor 4 (IRF4) and ferritin heavy chain 1 (FTH1).

WTAP expression and global m6A levels were significantly reduced in restenotic tissues and cells. WTAP overexpression restored m6A modification on GAS5, enhancing its stability via YTH domain family member 1. GAS5 inhibited EZH2-mediated H3K27me3 repression of IRF4, which transcriptionally activated FTH1, suppressing ferroptosis. WTAP overexpression decreased ROS, lipid peroxidation, and VSMC proliferation, while knockdown of GAS5 or IRF4 partially reversed these effects.

Innovation:

Our study is the first to identify that the WTAP/GAS5/IRF4 axis suppresses PDGF-BB-induced cell proliferation by inhibiting ferroptosis in VSMCs, and alleviates vascular restenosis caused by balloon injury.

Conclusion:

WTAP epitranscriptomically regulates VSMC ferroptosis via the GAS5/EZH2/IRF4/FTH1 axis, revealing a novel mechanism in vascular restenosis pathogenesis and a potential therapeutic target. Antioxid. Redox Signal. 44, 726–747.

Keywords

vascular restenosis ferroptosis WTAP GAS5 IRF4

Introduction

Vascular restenosis represents a frequent complication following interventional or surgical management of arterial disorders (Indolfi et al., 2019). Vascular smooth muscle cells (VSMCs), the dominant cellular component of the arterial wall, play a pivotal role in maintaining vascular homeostasis with limited migratory or proliferative capacity (Efovi and Xiao, 2022). However, cellular microenvironmental insults prompt VSMCs to undergo a phenotypic switch to a synthetic state, resulting in aberrant proliferation, enhanced migration, extracellular matrix accumulation, and subsequent intimal hyperplasia and cardiovascular pathologies (Tang et al., 2022). Ferroptosis is characterized by the accumulation of iron-dependent lipid peroxides and impairment of antioxidant systems, which drives cell dysfunction and phenotypic alterations without immediate cell lysis (Dixon and Olzmann, 2024). Ferroptosis promotes VSMC dedifferentiation and phenotypic transition during neointimal hyperplasia, rather than directly inducing cell demise (Yin et al., 2024b). Nevertheless, the mechanistic role of ferroptosis in regulating VSMC proliferation and migration remains ill-defined. Notably, most existing studies focus on classical epigenetic (e.g., DNA methylation and histone modification) or transcriptional regulation of ferroptosis (Jiang et al., 2023). The epitranscriptomic regulatory mechanisms of ferroptosis in vascular restenosis, which is an emerging layer of post-transcriptional control, remain largely unaddressed. This critical knowledge gap hinders the development of novel targeted therapies for restenosis.

N6-methyladenosine (m6A) is a pervasive co-transcriptional RNA modification in higher eukaryotes (Jiang et al., 2021). As the most abundant internal modification of eukaryotic mRNAs, m6A methylation is dynamic and reversible: “writers” add methyl groups, “erasers” remove them, and “readers” recognize m6A sites to regulate mRNA stability, translation, or splicing, serving as a key post-transcriptional regulatory switch (Qin et al., 2020). Wilms tumor 1-associated protein (WTAP), serving as a regulatory subunit of the m6A machinery, recruits the methyltransferase complex to target mRNAs, thereby catalyzing m6A RNA methylation (Huang et al., 2022). Unlike classical epigenetic and transcriptional regulation, m6A modification exerts dynamic and reversible post-transcriptional control over mRNA stability, translation efficiency, and alternative splicing without altering genomic information (Khan et al., 2025). Emerging evidence shows that m6A levels decline during intimal hyperplasia to promote VSMC dysfunction, and WTAP downregulation in balloon injury (BI)-induced carotid lesions correlates with enhanced VSMC viability and abnormal proliferation (Fang et al., 2023; Ma et al., 2020; Zhu et al., 2020). However, whether WTAP modulates vascular restenosis by inhibiting ferroptosis and VSMC aberrant proliferation remains uninvestigated. Clinically, vascular restenosis remains a major challenge in interventional cardiology, as conventional therapies (e.g., drug-eluting stents) have limited long-term efficacy and are associated with complications such as in-stent thrombosis (Hong and Hong, 2022). Targeting ferroptosis and its epitranscriptomic regulatory pathways offers a promising novel therapeutic direction, as it may precisely intervene in VSMC phenotypic switching and intimal hyperplasia without disrupting normal vascular homeostasis (Wang et al., 2025), holding significant potential for improving clinical outcomes of vascular disease patients.

Long non-coding RNAs (lncRNAs) orchestrate protein regulatory networks and cell fate decisions through the establishment of specific, flexible, and robust transcriptional/post-transcriptional control mechanisms (Herman et al., 2022). LncRNA growth arrest specific 5 (GAS5) has been implicated in the pathological processes of cardiovascular cells, including apoptosis, inflammatory responses, proliferation, migration, and differentiation (Jiang and Ning, 2020). In the BI rat model, GAS5 impairs VSMC viability, triggers cell cycle arrest and apoptotic cell death, and attenuates neointimal formation (Tang et al., 2019). A prior investigation identified m6A modifications on GAS5 (Tu et al., 2023), leading us to postulate that WTAP-mediated m6A methylation modulates GAS5 expression to influence VSMC biology and vascular restenosis.

Enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) is a histone methyltransferase that participates in the proliferation and differentiation of VSMCs by mediating H3K27me3 modification (Luo et al., 2024). Prior research has validated that platelet-derived growth factor BB (PDGF-BB) stimulation upregulates EZH2 expression in VSMCs, augmenting H3K27me3 deposition at downstream targets and exerting transcriptional repression (Liang et al., 2019). Notably, lncRNAs can sequester EZH2, disrupting its chromatin association and reducing H3K27me3 levels at target loci, thereby promoting downstream gene activation (Pan et al., 2022; Yang et al., 2025). Interferon regulatory factor 4 (IRF4) exerts anti-inflammatory effects and regulates intracellular metabolic homeostasis (Ahmad et al., 2024). IRF4 activity can be regulated by H3K27me3 modification, and IRF4 is downregulated in human and mouse restenotic arteries (Cheng et al., 2017; Lopez-Lopez et al., 2023). We hypothesized that GAS5 may affect pathological progression in vascular restenosis through the EZH2/IRF4 axis.

Ferritin heavy chain 1 (FTH1), an essential subunit of the ferritin complex, regulates iron storage and release and is pivotal in maintaining iron homeostasis and antioxidant defense by chelating iron to avert oxidative damage (Muhoberac and Vidal, 2019). Our previous predictions showed that IRF4 can bind to FTH1. Of note, upregulation of FTH1 alleviates ferroptosis and prevents vascular restenosis (Zhang et al., 2024).

This study employs a BI rat model and VSMC culture system to dissect the mechanism by which WTAP modulates vascular restenosis via the GAS5/IRF4/FTH1 axis. The research aims to uncover novel therapeutic targets and provide mechanistic insights for vascular restenosis intervention.

Results

WTAP overexpression ameliorates vascular restenosis and inhibits ferroptosis

BI rat models were established to model vascular restenosis. Hematoxylin and eosin (H&E) staining revealed pronounced arterial stenosis in BI rats, with a markedly increased intima area (IA)/medial area (MA) ratio (p < 0.01, Fig. 1A–B) and elevated proliferating cell nuclear antigen (PCNA) expression (p < 0.01, Fig. 1E). Immunohistochemistry (IHC) and Western blot revealed downregulated WTAP expression in carotid tissues of BI rats (p < 0.01, Fig. 1A, C–E). Lentivirus-mediated WTAP overexpression in carotid arteries ameliorated vascular stenosis, as evidenced by reduced IA/MA ratio and PCNA expression (p < 0.01, Fig. 1A–B, E). Ferroptosis, an iron-dependent regulated cell death, is implicated in cardiovascular pathologies. BI treatment increased levels of malondialdehyde (MDA) and Fe²⁺ (p < 0.01, Fig. 1F–G), decreased glutathione (GSH) levels (p < 0.01, Fig. 1H), downregulated glutathione peroxidase 4 (GPX4) and FTH1, upregulated acyl-CoA synthetase long-chain family member 4 (ACSL4; p < 0.01, Fig. 1E), and elevated reactive oxygen species (ROS) levels (p < 0.01, Fig. 1I), indicating ferroptosis induction by BI. WTAP overexpression reversed ferroptosis-related alterations and alleviated vascular stenosis (p < 0.01, Fig. 1E–I), indicating a protective role of WTAP in maintaining VSMC homeostasis.

FIG. 1.

WTAP overexpression ameliorates vascular restenosis and inhibits ferroptosis. A rat model of vascular restenosis was established by BI treatment. Lentivirus containing WTAP overexpression vector (Lv-WTAP) was injected into the carotid arteries of BI rats, with Lv-NC as the control. (A) H&E staining and immunohistochemistry were used to observe the pathological structure of injured tissues and WTAP expression. (B) I/M ratio. (C) Positive expression of WTAP by IHC. (D) qRT-PCR was performed to detect WTAP expression in tissues. (E) Western blot was used to detect the expression of WTAP, PCNA, GPX4, FTH1, and ACSL4 in tissues, with β-actin as the internal reference. (F–H) Detection of MDA, Fe²⁺, and GSH contents in tissues using kits. (I) DHE fluorescence detection of ROS levels in tissues; n = 6, data are presented as mean ± standard deviation. One-way ANOVA was used for data comparisons in panels B, C, D, F, G, H, and I, and two-way ANOVA for data comparisons in panel E, with Tukey’s multiple comparisons test for post hoc analysis. **p < 0.01. ACSL4, acyl-CoA synthetase long-chain family member 4; ANOVA, analysis of variance; BI, balloon injury; DHE, dihydroethidium; FTH1, ferritin heavy chain 1; GPX4, glutathione peroxidase 4; GSH, glutathione; H&E, hematoxylin and eosin; IHC, immunohistochemistry; I/M, intima/media; MDA, malondialdehyde; PCNA, proliferating cell nuclear antigen; qRT-PCR, quantitative reverse transcription polymerase chain reaction; ROS, reactive oxygen species; WTAP, Wilms tumor 1-associated protein.

WTAP overexpression inhibits PDGF-BB-induced VSMC abnormal proliferation and ferroptosis

A cell model was established by treating A10 cells with 30 ng/mL PDGF-BB. Cell counting kit-8 (CCK-8) assay showed that PDGF-BB treatment increased cell viability (p < 0.01, Fig. 2A), 5-ethynyl-2′-deoxyuridine (EdU)-positive cells (p < 0.01, Fig. 2B), PCNA expression, and decreased WTAP expression (p < 0.01, Fig. 2C, E–F). Meanwhile, PDGF-BB induced an elevation of intracellular ROS levels (p < 0.01, Fig. 2G), MDA and Fe²⁺ contents (p < 0.01, Fig. 2H–I), reduction of GSH content (p < 0.01, Fig. 2J), downregulation of GPX4 and FTH1, and upregulation of ACSL4 (p < 0.01, Fig. 2C). Similarly, WTAP overexpression in A10 cells (p < 0.01, Fig. 2C–F) inhibited cell proliferation and ferroptosis (p < 0.01, Fig. 2A–C, G–J). Additionally, the ferroptosis inhibitor Fer-1 was added in PDGF-BB-treated A10 cells, showing that cell proliferation was reduced after inhibiting ferroptosis (p < 0.01, Fig. 2A–C, G–J). These results indicate that WTAP overexpression inhibits VSMC abnormal proliferation and ferroptosis.

FIG. 2.

WTAP overexpression inhibits PDGF-BB-induced VSMC abnormal proliferation and ferroptosis in vitro. A10 cells were transfected with WTAP overexpression vector (oe-WTAP) or control vector (oe-NC). Cells were treated with 30 ng/mL PDGF-BB, and ferroptosis was inhibited by 2.5 µM Fer-1 with DMSO as control. (A) Cell viability detected by CCK-8 assay. (B) Cell proliferation evaluated by EdU assay. (C) Western blot for WTAP, PCNA, GPX4, FTH1, and ACSL4 expression with β-actin as loading control. (D) qRT-PCR for transfection efficiency. (E–F) qRT-PCR and Western blot for WTAP expression. (G) DHE fluorescence for intracellular ROS levels. (H–J) Detection of MDA, Fe²⁺, and GSH contents by kits. n = 3, data are presented as mean ± SD. One-way ANOVA was used for data comparisons in panels A, B, E, F, G, H, I, and J; two-way ANOVA for data comparisons in panel C, with Tukey’s multiple comparisons test for post hoc analysis. t-test was used for data comparisons in panel D. **p < 0.01. ACSL4, acyl-CoA synthetase long-chain family member 4; ANOVA, analysis of variance; CCK-8, cell counting kit-8; DHE, dihydroethidium; DMSO, dimethylsulfoxide; EdU, 5-ethynyl-2′-deoxyuridine; FTH1, ferritin heavy chain 1; GPX4, glutathione peroxidase 4; GSH, glutathione; MDA, malondialdehyde; PCNA, proliferating cell nuclear antigen; PDGF, platelet-derived growth factor; ROS, reactive oxygen species; SD, standard deviation; VSMC, vascular smooth muscle cell; WTAP, Wilms tumor 1-associated protein.

WTAP stabilizes lncRNA GAS5 expression via m6A modification

Global m6A levels were detected in vivo and in vitro models. Results showed that global m6A modifications in carotid tissues and cells were decreased after BI treatment and PDGF-BB induction but were increased after WTAP overexpression (p < 0.01, Fig. 3A). SRAMP database analysis revealed m6A modification sites on GAS5 (Fig. 3B). Methylated RNA immunoprecipitation (MeRIP) assays showed that m6A modification levels on GAS5 were reduced in BI tissues and PDGF-BB-induced cells but were elevated upon WTAP overexpression (p < 0.01, Fig. 3C). RIP assay showed a positive correlation of YTH domain family member 1 (YTHDF1) enrichment on GAS5 with m6A levels (p < 0.01, Fig. 3D). PDGF-BB induction reduced GAS5 stability, which was reversed after WTAP overexpression (p < 0.01, Fig. 3G). YTHDF1 knockdown (p < 0.01, Figs. 3E–F) abrogated the stabilizing effect of WTAP on GAS5 (p < 0.01, Fig. 3G). GAS5 expression in tissues and cells mirrored m6A modification trends and was downregulated in model groups but was upregulated after WTAP overexpression (p < 0.01, Fig. 3H). YTHDF1 inhibition reduced GAS5 expression (p < 0.01, Fig. 3H). These results demonstrate that WTAP mediates m6A modification of GAS5 and enhances its stability in a YTHDF1-dependent manner, thereby upregulating GAS5 expression.

FIG. 3.

WTAP stabilizes lncRNA GAS5 expression via m6A modification. (A) Detection of total m6A modification levels in rat carotid artery tissues (n = 6) and A10 cells (n = 3). (B) Analysis of m6A modification sites on GAS5 using the SRAMP database. (C–D) MeRIP and RIP assays to detect m6A levels on GAS5 and YTHDF1 enrichment in rat carotid artery tissues (n = 6) and A10 cells (n = 3). (E–F) A10 cells were transfected with sh-YTHDF1 or sh-NC control, and YTHDF1 expression was detected by qRT-PCR and Western blot (with β-actin as the loading control), n = 3. (G) GAS5 expression in A10 cells treated with actinomycin D, n = 3. (H) qRT-PCR detection of GAS5 expression in rat carotid artery tissues (n = 6) and A10 cells (n = 3). Data are presented as mean ± standard deviation. One-way ANOVA was used for data comparisons in panels A and H; two-way ANOVA was used for data comparisons in panels C, D, and G, with Tukey’s multiple comparisons test used for post hoc analysis. t-test was used for data comparisons in panels E and F. **p < 0.01. ANOVA, analysis of variance; GAS5, growth arrest specific 5; lncRNA, long non-coding RNA; m6A, N6-methyladenosine; MeRIP, methylated RNA immunoprecipitation; YTHDF1, YTH domain family member 1; WTAP, Wilms tumor 1-associated protein.

GAS5 knockdown partially reverses inhibited VSMC abnormal proliferation and ferroptosis

To validate the above mechanism, GAS5 expression was knocked down in A10 cells (p < 0.01, Fig. 4A, B), followed by cotreatment with WTAP overexpression. Compared with WTAP overexpression alone, the combination group exhibited enhanced cell proliferation (p < 0.01, Fig. 4C, D), increased PCNA expression (p < 0.01, Fig. 4E), elevated ROS, MDA, Fe²⁺, and ACSL4 levels (p < 0.01, Fig. 4E–H), and decreased GPX4/FTH1 expression and GSH content (p < 0.05, Fig. 4E,I). Combined with Figure 2, these results indicate that GAS5 knockdown partially reverses abnormal VSMC proliferation and ferroptosis.

FIG. 4.

GAS5 knockdown partially reverses abnormal VSMC proliferation and ferroptosis. (A) A10 cells were transfected with shRNA targeting GAS5 (sh-GAS5) or control shRNA (sh-NC), and transfection efficiency was detected by qRT-PCR. Then, cells were co-treated with oe-WTAP under PDGF-BB induction. (B) qRT-PCR for GAS5 expression. (C) Cell viability was detected by CCK-8 assay. (D) Cell proliferation was detected by EdU assay. (E) Western blot for PCNA, GPX4, FTH1, and ACSL4 expression (β-actin as loading control). (F) DHE fluorescence for intracellular ROS. (G–I) Detection of MDA, Fe²⁺, and GSH levels using kits. n = 3, data are presented as mean ± SD t-test was used for data comparisons in panel A; one-way ANOVA was used for data comparisons in panels B, C, D, F, G, H, and I; two-way ANOVA was used for data comparisons in panel E, with Tukey’s multiple comparisons test used for post hoc analysis. *p < 0.05, **p < 0.01. ACSL4, acyl-CoA synthetase long-chain family member 4; ANOVA, analysis of variance; CCK-8, cell counting kit-8; DHE, dihydroethidium; EdU, 5-ethynyl-2′-deoxyuridine; FTH1, ferritin heavy chain 1; GAS-5, growth arrest specific 5; GSH-4, glutathione peroxidase 4; GSH, glutathione; MDA, malondialdehyde; PCNA, proliferating cell nuclear antigen; PDGF, platelet-derived growth factor; qRT-PCR, quantitative reverse transcription polymerase chain reaction; ROS, reactive oxygen species; SD, standard deviation; VSMC, vascular smooth muscle cell.

GAS5 binds to EZH2 to block EZH2-mediated H3K27me3 modification of the IRF4 promoter and promote IRF4 expression

Fluorescence in situ hybridization (FISH) and nuclear and cytoplasmic fractionation assays confirmed that GAS5 is primarily expressed in the nucleus (Fig. 5A–B). EZH2 expression was upregulated in the abnormally hyperplastic intima of BI rats and PDGF-BB-treated cells (Liang et al., 2019). RPISeq database analysis showed a high binding probability between GAS5 and EZH2 (Fig. 5C), which was validated by RNA pull-down and RIP assays (p < 0.01, Fig. 5D, E). EZH2 suppresses downstream gene expression by promoting histone H3K27me3 modification. IRF4 was downregulated in human and mouse restenotic arteries (Cheng et al., 2017). Chromatin immunoprecipitation (ChIP) analysis showed that H3K27me3 modification and EZH2 enrichment on the IRF4 promoter were increased after BI treatment and PDGF-BB induction, decreased upon WTAP overexpression, and increased again after GAS5 inhibition (p < 0.01, Fig. 5F). IRF4 expression was reduced after BI and PDGF-BB treatment, increased after WTAP overexpression, and decreased again after GAS5 inhibition (p < 0.05, Fig. 5G, H). To further clarify the relationship among GAS5, EZH2, and IRF4, EZH2 or GAS5 was overexpressed in A10 cells (p < 0.01, Fig. 5I, J). EZH2 overexpression increased H3K27me3 modification and EZH2 enrichment on the IRF4 promoter (p < 0.01, Fig. 5F) and reduced IRF4 expression (p < 0.01, Fig. 5K, L). Co-overexpression of GAS5 with EZH2 significantly decreased H3K27me3 modification and EZH2 enrichment (p < 0.01, Fig. 5F) and increased IRF4 expression (p < 0.05, Fig. 5K, L). Collectively, GAS5 regulates H3K27me3 modification at the IRF4 promoter by interacting with EZH2, thereby achieving the regulation of IRF4 expression.

FIG. 5.

GAS5 binds to EZH2 to block EZH2-mediated H3K27me3 modification of the IRF4 promoter and promote IRF4 expression. (A) Subcellular localization of GAS5 in A10 cells was detected by FISH, n = 3. (B) Subcellular localization of GAS5 was determined by nucleocytoplasmic fractionation assay, n = 3. (C) Binding probability analysis of GAS5 and EZH2 using the RPISeq database. (D–E) Binding of GAS5 to EZH2 was detected by RNA pull-down and RIP assays, n = 3. (F) ChIP assay for enrichment of H3K27me3 and EZH2 on the IRF4 promoter in rat carotid tissues (n = 6) and A10 cells (n = 3). (G–H) qRT-PCR and Western blot (with β-actin as loading control) for IRF4 expression in rat carotid tissues (n = 6) and A10 cells (n = 3). A10 cells were transfected with GAS5 overexpression vector (oe-GAS5) or EZH2 overexpression vector (oe-EZH2), with empty vector (oe-NC) as control. (I) Transfection efficiency was detected by qRT-PCR, n = 3. (J) Western blot for EZH2 expression (β-actin as loading control), n = 3. (K–L) qRT-PCR and Western blot (β-actin as loading control) for IRF4 expression, n = 3. Data are presented as mean ± SD. One-way ANOVA was used for data comparisons in panels E, G, H, K, and L; two-way ANOVA was used for data comparisons in panel F, with Tukey’s multiple comparisons test used for post hoc analysis. t-test was used for data comparisons in panels I and J. *p < 0.05, **p < 0.01. ANOVA, analysis of variance; EZH2, enhancer of zeste 2 polycomb repressive complex 2 subunit; FISH, fluorescence in situ hybridization; GAS5, growth arrest specific 5; IRF4, interferon regulatory factor 4; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

FIG. 5.

Continued

IRF4 knockdown partially restores VSMC abnormal proliferation and ferroptosis

To validate the above mechanism, IRF4 expression was knocked down in A10 cells (p < 0.05, Fig. 6A–C), followed by cotreatment with WTAP overexpression. Compared with WTAP overexpression alone, the combination group exhibited enhanced cell proliferation (p < 0.05, Fig. 6D, E), increased PCNA expression (p < 0.01, Fig. 6C), elevated ROS, MDA, Fe²⁺, and ACSL4 levels (p < 0.05, Fig. 6C,F–H), and decreased GPX4/FTH1 expression and GSH content (p < 0.05, Fig. 6C,I). Combined with Figure 2, knockdown of IRF4 attenuates ferroptosis in VSMCs.

FIG. 6.

IRF4 knockdown partially restores VSMC abnormal proliferation and ferroptosis. (A) A10 cells were transfected with shRNA targeting IRF4 (sh-IRF4) or control shRNA (sh-NC), and transfection efficiency was detected by qRT-PCR. Then, cells were co-treated with oe-WTAP under PDGF-BB induction. (B) qRT-PCR for IRF4 expression. (C) Western blot for IRF4, PCNA, GPX4, FTH1, and ACSL4 expression (β-actin as loading control). (D) Cell viability was detected by CCK-8 assay. (E) Cell proliferation was detected by EdU assay. (F) DHE fluorescence for intracellular ROS. (G–I) Detection of MDA, Fe²⁺, and GSH levels using kits. n = 3, data are presented as mean ± SD t-test was used for data comparisons in panel A; one-way ANOVA was used for data comparisons in panels B, D, E, F, G, H, and I; two-way ANOVA was used for data comparisons in panel C, with Tukey’s multiple comparisons test used for post hoc analysis. *p < 0.05, **p < 0.01. ACSL4, acyl-CoA synthetase long-chain family member 4; ANOVA, analysis of variance; CCK-8, cell counting kit-8; DHE, dihydroethidium; EdU, 5-ethynyl-2′-deoxyuridine; FTH1, ferritin heavy chain 1; GAS-5, growth arrest specific 5; GSH 4, glutathione peroxidase 4; IRF4, interferon regulatory factor 4; MDA, malondialdehyde; PCNA, proliferating cell nuclear antigen; PDGF, platelet-derived growth factor; qRT-PCR, quantitative reverse transcription polymerase chain reaction; ROS, reactive oxygen species; SD, standard deviation; VSMC, vascular smooth muscle cell.

IRF4 promotes FTH1 transcription and expression

JASPAR database prediction showed that IRF4 can bind to the FTH1 promoter sequence (Fig. 7A). ChIP assay results validated IRF4 enrichment on the FTH1 promoter, while IRF4 enrichment on the FTH1 promoter was decreased after BI treatment and PDGF-BB induction, increased upon WTAP overexpression, and decreased after GAS5 or IRF4 inhibition (p < 0.01, Fig. 7B). Dual-luciferase reporter assays showed that co-transfection of an IRF4 overexpression vector with a luciferase vector containing the WT FTH1 promoter sequence enhanced luciferase activity (p < 0.01, Fig. 7C). FTH1 transcription levels were positively correlated with IRF4 enrichment on the FTH1 promoter (p < 0.01, Fig. 7D), and protein expression was consistent with transcription levels (p < 0.05, Figs 1E, 2C, 4E, and 6C). These results indicate that IRF4 promotes FTH1 expression via transcription.

FIG. 7.

IRF4 promotes FTH1 transcription and expression. (A) Prediction of binding sites between IRF4 and FTH1 promoter sequence using the JASPAR database. (B) ChIP assay for IRF4 enrichment on the FTH1 promoter in rat carotid tissues (n = 6) and A10 cells (n = 3). (C) Dual-luciferase reporter assay to validate the binding of IRF4 to FTH1 promoter sequence, n = 3. (D) qRT-PCR detection of FTH1 expression in rat carotid tissues (n = 6) and A10 cells (n = 3). Data are presented as mean ± standard deviation. Two-way ANOVA was used for data comparisons in panels B and C; one-way ANOVA was used for data comparisons in panel D, with Tukey’s multiple comparisons test for post hoc analysis. **p < 0.01. ANOVA, analysis of variance; FTH1, ferritin heavy chain 1; IRF4, interferon regulatory factor 4; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

GAS5 knockdown partially aggravates vascular restenosis in BI rats

Finally, to validate the above mechanism, GAS5 expression was knocked down in rats (p < 0.01, Fig. 8A), followed by cotreatment with WTAP overexpression. Compared with WTAP overexpression alone, the combination group exhibited decreased IRF4 expression in carotid tissues (p < 0.01, Fig. 8A, B), aggravated vascular restenosis (Fig. 8C), increased IA/MA ratio (p < 0.01, Fig. 8C), elevated PCNA expression (p < 0.01, Fig. 8B), increased ROS levels (p < 0.01, Fig. 8D), elevated MDA and Fe²⁺ levels (p < 0.01, Fig. 8E, F), decreased GSH content (p < 0.01, Fig. 8G), downregulated GPX4 and FTH1, and upregulated ACSL4 (p < 0.01, Fig. 8A, B). Combined with Figure 1, these results indicate that GAS5 knockdown partially restores vascular restenosis and ferroptosis in BI rats.

FIG. 8.

GAS5 knockdown partially aggravates vascular restenosis in BI rats. A rat model of vascular restenosis was established via BI treatment. Lentivirus containing sh-GAS5 (Lv-sh-GAS5) or control shRNA (Lv-sh-NC) was injected into the carotid arteries of BI rats, followed by co-treatment with Lv-WTAP. (A) qRT-PCR detection of GAS5, IRF4, and FTH1 expression in tissues. (B) Western blot analysis of IRF4, PCNA, GPX4, FTH1, and ACSL4 expression with β-actin as the loading control. (C) H&E staining to observe pathological structures of injured tissues and calculate I/M ratio. (D) DHE fluorescence assay to detect ROS levels in tissues. (E–G) Detection of MDA, Fe²⁺, and GSH contents in tissues using kits; n = 6. Data are presented as mean ± standard deviation. One-way ANOVA was used for analysis of data comparisons in panels A, C, D, E, F, and G; two-way ANOVA for data comparisons in panel B, with Tukey’s multiple comparisons test used for post hoc analysis. **p < 0.01. ACSL4, acyl-CoA synthetase long-chain family member 4; ANOVA, analysis of variance; BI, balloon injury; FTH1, ferritin heavy chain 1; GAS-5, growth arrest specific 5; GPX4, glutathione peroxidase 4; H&E, hematoxylin and eosin; IRF4, interferon regulatory factor 4; PCNA, proliferating cell nuclear antigen.

Discussion

WTAP-centered epitranscriptomic regulation of VSMC ferroptosis

Currently, paclitaxel-coated balloons and drug-eluting stents represent the predominantly employed therapeutic strategies for vascular restenosis, yet their clinical efficacy and application scope present significant therapeutic challenges (Deglise et al., 2023). Thus, the development of innovative approaches to alleviate vascular restenosis remains an urgent translational need. This study demonstrates that in BI rats and PDGF-BB-stimulated VSMCs, WTAP promotes m6A modification to stabilize lncRNA GAS5 expression in a YTHDF1-dependent manner. GAS5 sequesters EZH2, blocking its catalytic activity for H3K27me3 deposition on the IRF4 promoter and leading to enhanced IRF4 expression, which transcriptionally upregulates FTH1, thereby inhibiting cellular ferroptosis and alleviating vascular restenosis pathology (Fig. 9).

FIG. 9.

WTAP promotes m6A modification to stabilize lncRNA GAS5 expression via YTHDF1. GAS5 binds to EZH2, blocking EZH2-mediated H3K27me3 on the IRF4 promoter, upregulating IRF4 expression, and promoting FTH1 expression, thereby inhibiting ferroptosis and ameliorating vascular restenosis. EZH2, enhancer of zeste 2 polycomb repressive complex 2 subunit; FTH1, ferritin heavy chain 1; GAS-5, growth arrest specific 5; IRF4, interferon regulatory factor 4; WTAP, Wilms tumor 1-associated protein.

WTAP: a multifaceted regulator in vascular physiology and pathology

In BI rats and PDGF-BB-treated VSMCs, WTAP expression and global m6A levels were downregulated. WTAP overexpression impairs VSMC functions, as evidenced by reduced PCNA expression and cell viability. A prior study has shown that total Panax notoginseng saponin treatment upregulates WTAP, which enhances p16 expression via m6A modification, thereby inhibiting VSMC viability, proliferation, and migratory potential (Zhu et al., 2020). WTAP has also been reported to exacerbate VSMC apoptosis by elevating the Bax/Bcl-2 ratio while attenuating proliferative capacity (Yu et al., 2022). Moreover, WTAP promotes endothelial-derived exosomal miR-302d-5p maturation in an m6A-dependent fashion, mitigating vascular calcification and senescence (Shan et al., 2024). WTAP stabilizes the endogenous antioxidant factor NFE2 like bZIP transcription factor 2 (NRF2) mRNA via m6A modification (Wang et al., 2023). Nrf2 activates antioxidant target genes HO-1, scavenges ROS, and inhibits inflammation, thereby ultimately restoring endothelial function of injured blood vessels and inhibiting vascular remodeling (Fusco et al., 2021). Nrf2 can promote hypoxia inducible factor 1 subunit alpha (HIF-1α) expression to inhibit the abnormal proliferation of VSMCs, thereby exerting a protective effect against BI-induced restenosis (Ling et al., 2019). Taken together, WTAP is a critical regulator of VSMC function and vascular remodeling.

Although the regulatory roles of WTAP in vascular physiological and pathological processes have been reported, there remain key research gaps in mechanisms of WTAP underlying ferroptosis in VSMCs and vascular restenosis. Our findings reveal that WTAP alleviated ferroptosis in carotid artery tissue and VSMCs, as evidenced by reduced ROS levels, upregulated FTH1 expression, and downregulated ACSL4. Ferroptosis represents a key mechanism driving VSMC phenotypic switching, as ferroptotic stress enhances VSMC proliferative capacity to promote neointimal hyperplasia (Yu et al., 2025). Another study has indicated that WTAP-mediated stabilization of SRY-box transcription factor 2 (SOX2) in an m6A-dependent manner inhibits ferroptosis in trophoblast cells and alleviates preeclampsia (Geng et al., 2025). Interestingly, in the context of acute kidney injury, WTAP promotes the expression of lamin B1 (LMNB1) via m6A modification and activates the nuclear factor kappa B subunit 1 (NF-κB) and Janus kinase 2/signal transducer and activator of transcription 3 (JAK2/STAT3) pathways, thereby facilitating inflammation, mitochondrial damage, and ferroptosis (Huang et al., 2024). WTAP aggravates hypoxia/reoxygenation-induced ferroptosis and oxidative stress in cardiomyocytes by enhancing KLF6 mRNA stability via m6A modification (Fang et al., 2024). This evidence indicates that the regulatory roles of WTAP in ferroptosis may differ in different disease contexts. Here, by uncovering the WTAP/GAS5/IRF4/FTH1 pathway, this study establishes, for the first time, the functional link between WTAP and ferroptosis in VSMCs during restenosis. In a BI rat model, YTHDF1 upregulation prevents neointima formation by recognizing m6A modification on SMC marker proteins (Tian et al., 2025). In line with this, our study revealed that YTHDF1 promotes GAS5 expression via m6A-dependent mechanisms. GAS5 upregulation can inhibit VSMC senescence and mitigate the risk of vascular remodeling and atherosclerosis (Chen et al., 2021). GAS5 overexpression stabilizes the p53-p300 interaction, promotes Caspase 3 cleavage, and arrests VSMCs in the G0/G1 phase (Tang et al., 2019). After inhibiting GAS5 in PDGF-BB-treated VSMCs and BI rats, we observed that PCNA expression was upregulated, cellular proliferative capacity was restored, and ferroptosis was exacerbated. Another investigation has found that GAS5 overexpression inhibits oxidative stress and ferroptosis in cardiac tissues by activating the ULK3/Hippo pathway, thereby alleviating heart failure (Ren and Zhao, 2024). Additionally, in erastin-induced endothelial progenitor cell, GAS5 overexpression promotes glucose metabolism reprogramming and upregulate SLC7A11 to restrict ferroptosis (Zhong et al., 2025). Taken together, WTAP suppresses ferroptosis and restricts VSMC abnormal proliferation via an m6A/YTHDF1/GAS5-dependent pathway.

The GAS5-EZH2-IRF4-FTH1 axis: downstream molecular network analysis of ferroptosis inhibition

EZH2, acting as an epigenetic regulator, is overexpressed VSMCs and promotes proliferation, migration, and neointimal hyperplasia during phenotypic switch via histone methylation (Liang et al., 2019; Yin et al., 2024a). Our results showed that GAS5 bound to EZH2, blocking H3K27me3 modification on the IRF4 promoter and thus restoring IRF4 expression. IRF4 inhibition in VSMCs enhanced cell proliferation, accompanied by increased levels of ROS, MDA, Fe²⁺, and ACSL4, as well as decreased expression of GPX4 and FTH1 and reduced GSH content, indicating that IRF4 inhibition exacerbated ferroptosis in VSMCs. IRF4 knockdown in mice resulted in exacerbated restenosis, accompanied by upregulation of PCNA, CyclinD1, and matrix metalloproteinase 2, thereby promoting neointima formation (Miao et al., 2025). Knockdown of IRF4 in mouse SMCs promotes neointimal thickening and dedifferentiation (Cheng et al., 2017). After IRF knockdown, the expression of SLC7A11 and GPX4 is downregulated, inducing ferroptosis in cardiac microvascular endothelial cells (Liu et al., 2023). In this study, we discovered a novel mechanism by which IRF4 protected against ferroptosis: IRF4 alleviated ferroptosis in VSMCs by transcriptionally promoting FTH1. A previous study has shown that FTH1 is a key protein alleviating ferroptosis in VSMCs during nanoparticle-based therapy for vascular restenosis (Zhang et al., 2024). Prevention of FTH1 degradation alleviates ferroptosis in VSMCs and inhibits vascular calcification (Wang et al., 2024). Additionally, forkhead box O1 (FOXO1) inhibits ferroptosis in cardiac myocytes and protects cardiac function by transcriptionally activating FTH1 expression (Ju et al., 2023). Overall, GAS5 promotes the expression of ferroptosis protective factor FTH1 via the EZH2/IRF4 axis, which inhibits ferroptosis in VSMCs and ameliorates vascular restenosis.

Epitranscriptome regulation in vascular biology and ferroptosis

Epitranscriptomic regulation represented by m6A modification has emerged as a novel layer complementing classical epigenetic and metabolic control in vascular biology and ferroptosis (Yang et al., 2023). m6A-mediated epitranscriptomic regulation is an integral component of a broader network of vascular pathophysiology that links RNA metabolism to cell death pathways and vascular remodeling, thereby influencing various vascular diseases (Chen et al., 2024). Unlike classical ferroptosis regulators, such as Fer-1 and iron chelators, that directly interfere with lipid peroxidation or iron homeostasis (He et al., 2024; Li et al., 2023), WTAP exerts anti-ferroptotic effects via m6A-mediated GAS5 stabilization, targeting RNA metabolism rather than direct metabolic intervention. Compared with vascular remodeling pathways that primarily drive VSMC proliferation transcriptionally (Liang et al., 2024; Lu et al., 2018), the WTAP/GAS5/IRF4 axis dually regulates ferroptosis and proliferation, offering more precise modulation. This epitranscriptomic pathway enriches the current regulatory landscape, providing a unique perspective beyond classical mechanisms.

The pathological interaction between VSMC proliferation and ferroptosis and its clinical translational significance

During vascular restenosis, the abnormal proliferation of VSMCs and ferroptosis interact and synergize under different pathological stages or regulatory conditions. First, inflammatory factors, oxidative stress, and mechanical injury drive VSMC phenotypic switch (Deglise et al., 2023). Meanwhile, ferroptosis amplifies local inflammatory responses, further stimulating VSMC abnormal proliferation and matrix remodeling to form a vicious cycle (Xu et al., 2024). However, ferroptosis may directly induce VSMC death in the late pathological stage, reducing cell number and thus inhibiting proliferation-driven intimal hyperplasia (Song et al., 2023b; Worssam and Jorgensen, 2021). Therefore, the roles of WTAP/GAS5/IRF4 in vascular restenosis require further in-depth investigation according to different pathological stages of restenosis, exploring whether WTAP/GAS5/IRF4 are involved in regulating the dynamic balance between VSMC ferroptosis and abnormal proliferation.

The WTAP/m6A/GAS5 axis holds promising translational potential for vascular restenosis therapy. Inspired by red blood cell microvesicle-based delivery systems for m6A regulators, WTAP activators or GAS5 hormone response element mimic oligonucleotides could be targeted to lesion sites to suppress VSMC ferroptosis (Li et al., 2024; Pickard and Williams, 2016). However, challenges still persist. WTAP exhibits context-dependent roles, risking off-target effects (Song et al., 2023a, 2023b). Additionally, improving tissue-specific delivery efficiency and validating safety in human clinical samples remain critical hurdles, as observed in m6A-targeted cardiovascular therapies (Qiu et al., 2023).

Limitation and future directions

Due to limitations of conditions and timeline, we have been prevented from supplementing relevant studies on human-derived cells and clinical tissues, as well as RNA-seq or MeRIP-seq, which we will further improve in our future research. In future studies, we will investigate more downstream signaling pathways of WTAP-mediated m6A modification, such as Nrf2, and explore their roles in different pathological stages of vascular restenosis. A prior study has shown that GAS5 can act as a ceRNA for miR-21 to inhibit PDGF-BB-induced proliferation and migration of VSMCs (Liu et al., 2019). In the future, we will explore the downstream ceRNA network of GAS5 and the involvement of other ferroptosis regulators (SLC7A11 and GPX4) in the regulation of vascular restenosis and other downstream targets of IRF4 to refine restenosis therapeutic approaches by regulating ferroptosis and proliferation.

Conclusion

The WTAP/GAS5/IRF4 axis alleviates vascular restenosis in BI rats by inhibiting ferroptosis in VSMCs.

Materials and Methods

Ethics statement

The study protocol was authorized by the Animal Ethics Committee of Wuxi No.2 People’s Hospital and complied with the National Research Council (2011).

Experimental animals

Sprague–Dawley rats (300–400 g, 10-week-old male) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). Before the experiment, rats were housed under controlled conditions: 20°C–26°C, 45%–55% humidity, 12-h light/dark cycle, with free access to water and standard rodent chow.

BI rat model establishment

The BI model was established with reference to a previous study (Cai et al., 2021). Rats were anesthetized by intraperitoneal pentobarbital sodium (30 mg/kg). The left external carotid artery was exposed via a midline neck incision. A 2.0 Fogarty arterial embolectomy catheter was introduced via arteriotomy and advanced to the common carotid artery. The balloon was blown up with 2 atm and withdrawn with rotational motion toward the external carotid artery, repeated three times. After catheter removal, the external carotid artery was ligated. Rats in the sham group underwent only carotid artery exposure without BI. Lentiviral vectors (Lv-WTAP for WTAP overexpression and LV-sh-GAS5 for GAS5 knockdown) and control lentiviruses (Lv-NC and LV-sh-NC; 5 × 10⁸ TU/mL, 100 μL) were administered to BI rats via polyethylene catheter insertion into the carotid artery (Zhang et al., 2015). All vectors and viral particles were provided by GenePharma (Shanghai, China). Prophylactic penicillin sodium (40 × 10⁴ IU/d) was administered intramuscularly for 3 consecutive days to prevent infection. At 4 weeks post-surgery, rats were euthanized using intraperitoneal pentobarbital sodium (800 mg/kg), and injured carotid arteries were collected for histological analysis (six rats per group) and western blot (remaining six rats per group).

Rats were randomly divided into 6 groups (12 rats/group): sham group (sham operation); BI group (BI only); BI + Lv-NC group (BI + control lentivirus); BI + Lv-WTAP group (BI + WTAP-overexpressing lentivirus); BI + Lv-WTAP + Lv-sh-NC group (BI + WTAP-overexpressing lentivirus + shRNA control lentivirus); and BI + Lv-WTAP + Lv-sh-GAS5 group (BI + WTAP-overexpressing lentivirus + sh-GAS5 lentivirus).

Histopathological detection

Excised rat carotid arteries were fixed in 4% paraformaldehyde and cut into 4-μm tissue sections. H&E staining was performed. Images were acquired using an optical microscope (Nikon, Tokyo, Japan). Morphological analysis was conducted with Image-Pro Plus software (Media Cybernetics, Inc., Rockville, MD, USA). IA = internal elastic lamina area – lumen area; MA = external elastic lamina area – internal elastic lamina area. The intima/media (I/M) ratio was calculated. At least five consecutive sections were examined per sample, the I/M ratio was calculated for each section separately, and the average value was then computed and used as the I/M ratio for each animal. All statistical analyses were performed by experimenters blinded to the study.

For IHC, arterial sections underwent high-pressure antigen retrieval after dewaxing and rehydration. Sections were blocked with 5% bovine serum albumin diluted in phosphate-buffered saline (PBS) for 60 min and then incubated with primary antibodies at 4°C overnight. After rewarming at 37°C for 1 h and washing with PBS, sections were incubated with secondary antibodies for 1 h, followed by staining with 3,3′-diaminobenzidine horseradish peroxidase chromogenic kit (ZLI-9017, ZSGB-BIO, Beijing, China). Primary antibodies were as follows: anti-WTAP (1:2000, PA5-144681, Invitrogen, Carlsbad, CA, USA) and immunoglobulin G (IgG) (1:200, 31210, Invitrogen).

Cell culture and treatment

Rat thoracic aortic smooth muscle cell line (A10 cells) from American Type Culture Collection (ATCC) (Manassas, VA, USA) was cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) at 37°C in a 5% CO₂ humidified atmosphere. After growing to 60%–70% confluence, cells were starved in FBS-free DMEM for 24 h and then cultured in DMEM with 10% FBS and 30 ng/mL PDGF-BB (Yang et al., 2024) for 24 h. Medium was changed every other day. Confluent cells were passaged by trypsinization. Cells after treatment underwent ice-cold PBS washing and were collected for further analysis.

When A10 cells reached 70% confluence, transient transfection was conducted using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. WTAP was overexpressed by transfection of pcDNA-WTAP (oe-WTAP) carrying WTAP cDNA; GAS5 by pcDNA-GAS5 (oe-GAS5); and EZH2 by pcDNA-EZH2 (oe-EZH2). GAS5, IRF4, and YTHDF1 were silenced by transfecting short hairpin RNAs (sh-GAS5, sh-IRF4, and sh-YTHDF1). Negative controls (sh-NC and oe-NC) were provided by GenePharma. Cells were collected 36 h after transfection for total protein/RNA isolation or PDGF-BB treatment. Ferrostatin-1 (Fer-1, 2.5 µM, MCE, Monmouth Junction, NJ, USA) was added to inhibit ferroptosis, with dimethylsulfoxide as control (Shi et al., 2023).

CCK-8 assay

Cell proliferation was measured using CCK-8 method. VSMCs with different treatments were seeded into 96-well plates (1 × 10⁴ cells/well) and cultured for 24 h. CCK-8 (0.2 mg/mL) was added to each well, and plates were incubated at 37°C for 4 h. Absorbance at 450 nm was measured using a microplate reader, with the control group set as 100%. The experiment was independently repeated three times.

ROS detection

ROS levels were detected using the ROS-sensitive fluorescent probe dihydroethidium (DHE). Cells seeded in 6-well plates (6 × 10⁴ cells/well) were treated as described above for 24 h and then incubated with 10 μM DHE at 37°C for 45 min. Oxidized DHE diffused into cells, and ROS levels were observed by fluorescence microscopy. The experiment was independently repeated three times. Carotid artery sections were treated with 10 μM DHE in PBS for 45 min at 37°C, washed with PBS for three times, and stained with 4’,6-diamidino-2-phenylindole (DAPI) for nuclei. The images were shot using a Leica DM3000 microscope (Leica Microsystems GmbH, Wetzlar, Germany). Three high-power fields (400×) were randomly selected for each section, followed by analysis. The mean intensity of red fluorescence per high-power fields was calculated.

Detection of Fe²⁺, MDA, and GSH

Commercial kits were used to evaluate the levels of factors in carotid tissues or A10 cells following instructions. GSH levels in tissues and cells were detected using a GSH kit (A006-1-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). MDA levels were measured using an MDA kit (S0131, Beyotime, Shanghai, China). Iron content was determined using an iron assay kit (ab83366, abcam, Cambridge, MA, USA), following the manufacturer’s protocols.

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Total RNA (1 µg) was mixed with 2 µL of 5X qRT SuperMix (HiScript™ Q RT SuperMix qPCR Kit, Cat. No. R122-01; Vazyme Biotech, Nanjing, Jiangsu, China), supplemented with RNase-free water to a total volume of 10 µL, and subjected to RT at 50°C for 15 min to generate cDNA. mRNA levels were quantified by RT-qPCR using AceQ qPCR SYBR Green Master Mix (Cat. No. Q111; Vazyme Biotech). Specifically, cDNA obtained after RT was diluted 10-fold, and 2 µL of the diluted cDNA was mixed with 5 µL of AceQ qPCR SYBR Green Master Mix and 50 µM primer (0.15 µL of each), followed by adding distilled water to a total volume of 10 µL. Amplification was performed using a LightCycler® Nano system (Roche Diagnostics, Basel, Switzerland) under the following conditions: pre-denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 10 s and 60°C for 30 s. Glyceraldehyde phosphate dehydrogenase served as the internal reference for normalizing mRNA expression levels. Quantitative cycle values were calculated by employing the instrument software. Relative expression levels were determined by the 2^-ΔΔCt method (Livak and Schmittgen, 2001). Primer sequences are listed in Table 1.

Table 1.

PCR Primer Sequences

Gene	Sequences (5'−3')
WTAP	F: ACCTCAAGCAAGTTCAGCAG
WTAP	R: TGGGCTTGTTCCAGTTTGTC
GAS5	F: TTTCAAGGGCTCCTCTGACAAG
GAS5	R: GTTCAAGCATCCATCCAGTCAC
EZH2	F: ACATCGATGGACCAAATGCC
EZH2	R: TTGGGTGTTGCATGAAAGGG
IRF4	F: TTCACTCATTCCTTGCCTACGG
IRF4	R: ACTGGCTTTCCAAACGCATC
IRF4 promoter	F: TGTGCGTTGTCTGAGTCATC
IRF4 promoter	R: AAACCGTGGCCCAGATAAAC
YTHDF1	F: AGCTACTACCCACCATCCATTG
YTHDF1	R: TGCCCAAAAACAGCATCGTG
FTH1	F: TCAACCGCCAGATCAACCTG
FTH1	R: CAAAGTTCTTCAGGGCCACATC
FTH1 promoter	F: CTTCAAGGACAAACCCAAGGTTA
FTH1 promoter	R: AGGACAGCCATCTTAGGGGAGTC
U6	F: CTGCACTTATTTCAGAAGCAGATA
U6	R: CCTTGCACCTGGGCCATAA
GAPDH	F: ATGCCCCCATGTTTGTGATG
GAPDH	R: TCCACGATGCCAAAGTTGTC

EZH2, enhancer of zeste 2 polycomb repressive complex 2 subunit; FTH1, ferritin heavy chain 1; GAPDH, glyceraldehyde phosphate dehydrogenase; GAS5, growth arrest specific 5; IRF4, interferon regulatory factor 4; WTAP, Wilms tumor 1-associated protein; YTHDF1, YTH domain family member 1.

Western blot

Total proteins were extracted from tissues or cells using radioimmunoprecipitation assay (RIPA) lysis buffer for standard western blot analysis. Briefly, cell or tissue lysates were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. Blots were blocked with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween 20 and probed with diluted antibodies against WTAP (1:1000, PA5-144681, Invitrogen), PCNA (1:1000, PA5-27214, Invitrogen), GPX4 (1:2000, ab125066, Abcam), ACSL4 (1:10000, ab155282, Abcam), FTH1 (1:1000, ab75973, Abcam), EZH2 (1:1000, ab307646, Abcam), IRF4 (1:1000, 15106, CST, Cell Signaling Technology, Danvers, MA, USA), YTHDF1 (1:1000, ab220162, Abcam), and β-actin (1:2000, ab8227, Abcam). Blots were then incubated with secondary antibody IgG (1:5000, ab6721, Abcam), processed with enhanced chemiluminescence (Vazyme, E412-01/02), and scanned using an EPSON (V19ii/V39ii) scanner.

EdU assay

Cell density was standardized, and 5 × 10⁵ cells/well were plated onto coverslips in 6-well plates. Cells were synchronized in serum-free DMEM for 24 h, followed by culture in DMEM containing 10% FBS for an additional 24 h. Cells were grouped for transfection, followed by stimulation with PDGF-BB for 24 h. EdU was added and incubated for 2 h. Cells were fixed with 4% paraformaldehyde for 15 min at room temperature and then permeabilized with PBS containing 0.3% Triton X-100 for 15 min. Cells were treated with Click reaction solution and incubated in the dark for 30 min, followed by DAPI staining for 10 min in the dark at room temperature. Coverslips were removed, and cell staining was observed under a fluorescence microscope (Olympus, Tokyo, Japan). The EdU positive index was determined by counting EdU-positive cells and total cells in five random fields per sample. The experiment was independently repeated three times.

Bioinformatics analysis

The SRAMP database (https://www.cuilab.cn/m6asiteapp/old; Fan et al., 2024) was used for online analysis of m6A modification sites on GAS5. The JASPAR database (https://jaspar.elixir.no/; Rauluseviciute et al., 2024) was employed to analyze binding sites between IRF4 and the FTH1 promoter sequence. The RPISeq database (http://pridb.gdcb.iastate.edu/RPISeq/index.html; Muppirala et al., 2011) was utilized to predict the binding probability between GAS5 and EZH2.

Total m6A detection and MeRIP assay

Total m6A mRNA levels were detected using an m6A RNA methylation detection kit (ab185912, Abcam). According to the protocol, 200 ng of mRNA was incubated with 80 μL binding buffer at 37°C for 90 min, followed by addition of 50 μL diluted capture antibody for 60 min at room temperature. Then, 50 μL diluted detection antibody was added for 30 min, followed by 100 μL developer solution in the dark for 10 min. After adding stop solution, absorbance was measured at 450 nm.

A commercial riboMeRIP m6A transcriptome analysis kit (C11051, Ribobio, Guangzhou, Guangdong, China) was used. Briefly, total RNA was isolated using TRIzol and fragmented with an RNA fragmentation buffer. Protein A/G magnetic beads were washed with IP buffer and incubated with an m6A-specific antibody (5 μg per IP reaction) for 30 min. The beads were rinsed with IP buffer, combined with 100 ng RNA, RNase inhibitor, and IP buffer and then gently rotated at 4°C for 2 h. After elution buffer washing (5× IP buffer, 20 mM m6A, RNase inhibitor, nuclease-free water), m6A-IP RNA was recovered by ethanol precipitation, and the final RNA samples were resuspended using 10 μL water.

RIP

RIP was conducted using the Magna RIP™ RNA-binding protein immunoprecipitation kit (17-700, Millipore, Billerica, MA, USA) according to the protocol. Cell lysates were collected with RIP lysis buffer. Protein A/G magnetic beads were incubated with control IgG antibody (1:30, ab7092, Abcam) or YTHDF1 antibody (1:30, ab220162, Abcam) at room temperature for 30 min. Cell lysates were then incubated with bead-antibody mixtures at 4°C for 4 h (10% input). Immunoprecipitated RNA was isolated after digestion with proteinase K (HY-108717, MCE) for quantitative PCR analysis.

RNA stability assay

Actinomycin D (2 μg/mL; Sigma, St. Louis, MO, USA) was added to cells, and samples were collected at 0, 4, 8, and 12 h. Total RNA was extracted at specified time points for qRT-PCR analysis of remaining RNA.

FISH

FISH was conducted by the FISH Tag™ RNA Green kit (RiboBio Co., Ltd.) to determine the subcellular localization of GAS5. Cells were seeded in 6-well plates, and after 1 day of culture (80% confluence), cells were washed with PBS and fixed with 4% paraformaldehyde at room temperature. Following proteinase K, glycine, and phthalate reagent treatment, cells were pre-hybridized with pre-hybridization solution at 42°C for 1 h. Pre-hybridization solution was removed, and hybridization solution containing probes was added for overnight incubation at 42°C, followed by three washes with PBST. Nuclei were stained with DAPI diluted in PBS/Tween. Cells seeded in 24-well plates were stained for 5 min, washed thrice with PBS/Tween (3 min for each), mounted with antifluorescence quencher, and checked under a fluorescence microscope (Olympus).

Nuclear and cytoplasmic fractionation

Cytoplasm and nuclei were isolated using a kit (Thermo Scientific, MA, USA). Cells underwent centrifugation and 100–500 μL pre-chilled cell disruption buffer for lysis. Then, cells were incubated on ice for 5–10 min and centrifuged at 500 g for 1–5 min at 4°C. The cytoplasmic layer was transferred to an RNase-free tube. Nuclei were washed with pre-chilled cell disruption buffer, followed by centrifugation (500 g, 1–5 min), and the supernatant was discarded. Isolated nuclei were used for RNA extraction.

RNA pull-down assay

Total RNA was extracted from cells using TRIzol (Sigma-Aldrich). Primers containing the T7 promoter sequence for GAS5 and antisense GAS5 were used for RT and amplification by qPCR. Following purification, amplified products were transcribed in vitro into RNA using the Transcript Aid T7 High Yield Transcription Kit (Thermo Fisher Scientific). Biotinylated RNA was generated with the Pierce™ RNA 3′ End Desulfobiotinylation Kit (Thermo Fisher Scientific). Cells were lysed in RIPA lysis buffer, and streptavidin magnetic beads conjugated with biotinylated lncRNA GAS5 were incubated with the cell lysate at 4°C overnight. Following washing and elution of RNA-binding protein complexes, the eluates were subjected to Western blot.

ChIP

Samples were cross-linked with 1% formaldehyde for 10 min at room temperature, and the reaction was terminated with glycine. After centrifugation, pellets were collected in cold lysis buffer and sonicated. Samples were immunoprecipitated with antibodies against EZH2 (1:50, ab307646, Abcam), H3K27me3 (1:100, ab192985, Abcam), IRF4 (1:50, 15106, Cell Signaling Technology), or IgG (1:1000, MA5-56524, Invitrogen) and incubated with protein A/G magnetic beads (B23202, Biotool, Shanghai, China). The beads were rinsed twice with low-salt wash buffer (2 mmol/L Ethylene Diamine Tetraacetic Acid, EDTA, 20 mmol/L Tris-HCl, pH 8.0, 0.1% SDS, 1% Triton X-100, 150 mmol/L NaCl), once with high-salt wash buffer (2 mmol/L EDTA, 20 mmol/L Tris-HCl, pH 8.0, 0.1% SDS, 1% Triton X-100, 500 mmol/L NaCl), once with LiCl wash buffer (1 mmol/L EDTA, 10 mmol/L Tris-HCl, pH 8.0, 250 mmol/L LiCl, 1% deoxycholic acid, 200 mmol/L NaCl, 1% NP-40), and once with TE buffer (1 mmol/L EDTA, 10 mmol/L Tris-HCl, pH 8.0). Following washing, the beads were redispersed in elution buffer (1% SDS, 0.1 mol/L NaHCO₃) to elute protein/DNA complexes. Eluates were reverse-crosslinked by incubation with proteinase K and 5 mol/L NaCl at 65°C overnight. DNA was recovered using a DNA purification kit (D0033, Beyotime) for quantitative PCR analysis, with primers listed in Table 1.

Dual-luciferase reporter assay

To investigate whether IRF4 directly acts on the FTH1 promoter region, wild-type (WT) and mutant (MUT, with mutations at specific sites) sequences of the FTH1 promoter region were cloned into pGL3-basic to construct luciferase reporter vectors (knoigene, Chongqing, China). Cells were transfected with DNA vectors containing WT/MUT vectors and an IRF4 overexpression vector. A vector containing the Renilla luciferase gene was introduced as an internal control. Forty-eight hours after transfection, cells were seeded into 96-well plates and incubated at 37°C with 5% CO₂ overnight. Luciferase expression was detected using the dual-luciferase reporter assay system kit (Promega, WI, USA), and firefly and Renilla luciferase activities were measured using a multimode microplate reader.

Statistical analysis

All data were analyzed using SPSS 21.0 (IBM SPSS Statistics, Chicago, IL, USA) and GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). Normality and homogeneity of variance were first tested. Data conforming to normal distribution and homogeneous variance were expressed as mean ± standard deviation. Two-group comparisons were performed using t-test, and multiple-group comparisons were analyzed by one-way or two-way analysis of variance, followed by Tukey’s multiple comparisons test. p < 0.05 was considered statistically significant, and p < 0.01 indicated extremely significant differences. Electronic laboratory notebook was not used.

Authors’ Contributions

Y.W.Y.: Conceptualization, writing—original draft, data analysis, and visualization. F.M.L.: Conceptualization, writing—original draft, and data analysis. Z.H.D.: Research, data analysis, and writing—review and editing. S.Q.C.: Data acquisition and writing—review and editing. Z.K.Z.: Data analysis, funding acquisition, writing—review and editing.

Footnotes

Author Disclosure Statement

The authors declare no competing interests.

Funding Information

This work was supported by the Youth Fund Project of Wuxi Municipal Health Commission (Q202327).

Data Availability Statement

The datasets used and analyzed during this study are available from the corresponding author upon reasonable request.

Abbreviations

References

Ahmad

, Kahloan

, Rosen

. Transcriptional control of metabolism by interferon regulatory factors. Nat Rev Endocrinol, 2024; 20(10):573–587; doi: 10.1038/s41574-024-00990-0

Cai

, Wu

, Yang

, et al. Sodium selenite attenuates balloon injury-induced and monocrotaline-induced vascular remodeling in rats. Front Pharmacol, 2021; 12:618493; doi: 10.3389/fphar.2021.618493

Chen

, Li

. The role of m6A in angiogenesis and vascular diseases. iScience, 2024; 27(7):110082; doi: 10.1016/j.isci.2024.110082

Chen

, Liang

, Xu

, et al. MiR-665 regulates vascular smooth muscle cell senescence by interacting with LncRNA GAS5/SDC1. Front Cell Dev Biol, 2021; 9:700006; doi: 10.3389/fcell.2021.700006

Cheng

, She

, Qin

, et al. Interferon regulatory factor 4 inhibits neointima formation by engaging kruppel-like factor 4 signaling. Circulation, 2017; 136(15):1412–1433; doi: 10.1161/CIRCULATIONAHA.116.026046

Deglise

, Bechelli

, Allagnat

. Vascular smooth muscle cells in intimal hyperplasia, an update. Front Physiol, 2023; 13:1081881; doi: 10.3389/fphys.2022.1081881

Dixon

, Olzmann

. The cell biology of ferroptosis. Nat Rev Mol Cell Biol, 2024; 25(6):424–442; doi: 10.1038/s41580-024-00703-5

Efovi

, Xiao

. Noncoding RNAs in vascular cell biology and restenosis. Biology (Basel), 2022; 12(1):24; doi: 10.3390/biology12010024

Fan

, Cui

, Kang

, et al. A combined deep learning framework for mammalian m6A site prediction. Cell Genom, 2024; 4(12):100697; doi: 10.1016/j.xgen.2024.100697

10.

Fang

, Li

, Wu

. Wtap-mediated M6a modification of Klf6 aggravates hypoxia/reoxygenation-induced human cardiomyocyte injury. Shock, 2024; 62(2):201–207; doi: 10.1097/SHK.0000000000002373

11.

Fang

, Zhang

, Luo

, et al. Methyltransferase-like 3 suppresses phenotypic switching of vascular smooth muscle cells by activating autophagosome formation. Cell Prolif, 2023; 56(4):e13386; doi: 10.1111/cpr.13386

12.

Fusco

, Siracusa

, Gugliandolo

, et al. Micro composite palmitoylethanolamide/rutin reduces vascular injury through modulation of the Nrf2/HO-1 and NF-kB pathways. Curr Med Chem, 2021; 28(30):6287–6302; doi: 10.2174/0929867328666210329120213

13.

Geng

, Zhou

, Zhang

, et al. WTAP targets SOX2 to inhibit trophoblast ferroptosis in the pathogenesis of preeclampsia via m6A-dependent ferroptosis regulation. Cell Signal, 2025; 133:111881; doi: 10.1016/j.cellsig.2025.111881

14.

, Xiong

, Liu

, et al. Ferrostatin-1 inhibits ferroptosis of vascular smooth muscle cells and alleviates abdominal aortic aneurysm formation through activating the SLC7A11/GPX4 axis. FASEB J, 2024; 38(2):e23401; doi: 10.1096/fj.202300198RRR

15.

Herman

, Tsitsipatis

, Gorospe

. Integrated lncRNA function upon genomic and epigenomic regulation. Mol Cell, 2022; 82(12):2252–2266; doi: 10.1016/j.molcel.2022.05.027

16.

Hong

, Hong

. Drug-eluting stents for the treatment of coronary artery disease: A review of recent advances. Expert Opin Drug Deliv, 2022; 19(3):269–280; doi: 10.1080/17425247.2022.2044784

17.

Huang

, Wang

, Lv

, et al. WTAP-mediated N6-methyladenosine modification promotes the inflammation, mitochondrial damage and ferroptosis of kidney tubular epithelial cells in acute kidney injury by regulating LMNB1 expression and activating NF-kappaB and JAK2/STAT3 pathways. J Bioenerg Biomembr, 2024; 56(3):285–296; doi: 10.1007/s10863-024-10015-0

18.

Huang

, Mo

, Liao

, et al. The RNA m(6)A writer WTAP in diseases: Structure, roles, and mechanisms. Cell Death Dis, 2022; 13(10):852; doi: 10.1038/s41419-022-05268-9

19.

Indolfi

, Iaconetti

, Gareri

, et al. Non-coding RNAs in vascular remodeling and restenosis. Vascul Pharmacol, 2019; 114:49–63; doi: 10.1016/j.vph.2018.10.006

20.

Jiang

, Liu

, Nie

, et al. The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther, 2021; 6(1):74; doi: 10.1038/s41392-020-00450-x

21.

Jiang

, Ning

. The mechanisms of lncRNA GAS5 in cardiovascular cells and its potential as novel therapeutic target. J Drug Target, 2020; 28(10):1012–1017; doi: 10.1080/1061186X.2020.1769108

22.

Jiang

, Song

, Liu

, et al. Epigenetic regulation of programmed cell death in hypoxia-induced pulmonary arterial hypertension. Front Immunol, 2023; 14:1206452; doi: 10.3389/fimmu.2023.1206452

23.

, Li

, Zhao

, et al. Circular RNA FEACR inhibits ferroptosis and alleviates myocardial ischemia/reperfusion injury by interacting with NAMPT. J Biomed Sci, 2023; 30(1):45; doi: 10.1186/s12929-023-00927-1

24.

Khan

, Halawi

, Almehmadi

, et al. Epitranscriptomic regulation in cardiovascula disease: Mechanistic roles and clinical implications of m6A RNA methylation in cardiac pathophysiology. Curr Probl Cardiol, 2025; 51(4):103253; doi: 10.1016/j.cpcardiol.2025.103253

25.

, Wei

, Hu

, et al. Deciphering m(6)A methylation in monocyte-mediated cardiac fibrosis and monocyte-hitchhiked erythrocyte microvesicle biohybrid therapy. Theranostics, 2024; 14(9):3486–3508; doi: 10.7150/thno.95664

26.

, Cheng

, Luo

, et al. Therapeutic potential of iron chelators in retinal vascular diseases. Int J Ophthalmol, 2023; 16(11):1899–1910; doi: 10.18240/ijo.2023.11.24

27.

Liang

, Lv

, Huang

, et al. Loss of smooth muscle tenascin-X inhibits vascular remodeling through increased TGF-beta signaling. Arterioscler Thromb Vasc Biol, 2024; 44(8):1748–1763; doi: 10.1161/ATVBAHA.123.321067

28.

Liang

, Li

, Cai

, et al. Inhibition of polycomb repressor complex 2 ameliorates neointimal hyperplasia by suppressing trimethylation of H3K27 in vascular smooth muscle cells. Br J Pharmacol, 2019; 176(17):3206–3219; doi: 10.1111/bph.14754

29.

Ling

, Xu

, Chen

, et al. Protective effect of a hydrogen sulfide donor on balloon injury-induced restenosis via the Nrf2/HIF-1alpha signaling pathway. Int J Mol Med, 2019; 43(3):1299–1310; doi: 10.3892/ijmm.2019.4076

30.

Liu

, Liu

, Zhang

. lncRNA GAS5 acts as a ceRNA for miR-21 in suppressing PDGF-bb-induced proliferation and migration in vascular smooth muscle cells. J Cell Biochem, 2019; 120(9):15233–15240; doi: 10.1002/jcb.28789

31.

Liu

, Yang

, Huo

, et al. Lutein suppresses ferroptosis of cardiac microvascular endothelial cells via positive regulation of IRF in cardiac hypertrophy. Eur J Pharmacol, 2023; 959:176081; doi: 10.1016/j.ejphar.2023.176081

32.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods, 2001; 25(4):402–408; doi: 10.1006/meth.2001.1262

33.

Lopez-Lopez

, Romero de Avila

, Gonzalez-Gomez

, et al. NOTCH4 potentiates the IL-13 induced genetic program in M2 alternative macrophages through the AP1 and IRF4-JMJD3 axis. Int Immunol, 2023; 35(10):497–509; doi: 10.1093/intimm/dxad028

34.

, Wan

, Wang

, et al. Chicoric acid prevents PDGF-BB-induced VSMC dedifferentiation, proliferation and migration by suppressing ROS/NFkappaB/mTOR/P70S6K signaling cascade. Redox Biol, 2018; 14:656–668; doi: 10.1016/j.redox.2017.11.012

35.

Luo

, Li

, Song

, et al. Role of EZH2-mediated epigenetic modification on vascular smooth muscle in cardiovascular diseases: A mini-review. Front Pharmacol, 2024; 15:1416992; doi: 10.3389/fphar.2024.1416992

36.

, Liu

, Zhang

, et al. Vascular smooth muscle FTO promotes aortic dissecting aneurysms via m6A modification of Klf5. Front Cardiovasc Med, 2020; 7:592550; doi: 10.3389/fcvm.2020.592550

37.

Miao

, Yong

, Zheng

, et al. Artesunate inhibits neointimal hyperplasia by promoting IRF4 associated macrophage polarization. Adv Sci (Weinh), 2025; 12(19):e2408992; doi: 10.1002/advs.202408992

38.

Muhoberac

, Vidal

. Iron, ferritin, hereditary ferritinopathy, and neurodegeneration. Front Neurosci, 2019; 13:1195; doi: 10.3389/fnins.2019.01195

39.

Muppirala

, Honavar

, Dobbs

. Predicting RNA-protein interactions using only sequence information. BMC Bioinformatics, 2011; 12:489; doi: 10.1186/1471-2105-12-489

40.

National Research Council. In: Guide for the Care and Use of Laboratory Animals. The National Academies Press: Washington, DC; 2011.

41.

Pan

, Wang

, Zhang

, et al. Chromosomal instability-associated MAT1 lncRNA insulates MLL1-guided histone methylation and accelerates tumorigenesis. Cell Rep, 2022; 41(11):111829; doi: 10.1016/j.celrep.2022.111829

42.

Pickard

, Williams

. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells. Oncotarget, 2016; 7(9):10104–10116; doi: 10.18632/oncotarget.7173

43.

Qin

, Li

, Luo

, et al. Role of m6A RNA methylation in cardiovascular disease (Review). Int J Mol Med, 2020; 46(6):1958–1972; doi: 10.3892/ijmm.2020.4746

44.

Qiu

, Jing

, Li

, et al. RNA modification: Mechanisms and therapeutic targets. Mol Biomed, 2023; 4(1):25; doi: 10.1186/s43556-023-00139-x

45.

Rauluseviciute

, Riudavets-Puig

, Blanc-Mathieu

, et al. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res, 2024; 52(D1):D174–D182; doi: 10.1093/nar/gkad1059

46.

Ren

, Zhao

. Bone marrow mesenchymal stem cells-derived exosomal lncRNA GAS5 mitigates heart failure by inhibiting UL3/Hippo pathway-mediated ferroptosis. Eur J Med Res, 2024; 29(1):303; doi: 10.1186/s40001-024-01880-x

47.

Shan

, Lin

, Wu

, et al. Vascular wall microenvironment: Endothelial cells original exosomes mediated melatonin-suppressed vascular calcification and vascular ageing in a m6A methylation dependent manner. Bioact Mater, 2024; 42:52–67; doi: 10.1016/j.bioactmat.2024.08.021

48.

Shi

, Wang

, Wei

, et al. Histone acetyltransferase P300 deficiency promotes ferroptosis of vascular smooth muscle cells by activating the HIF-1alpha/HMOX1 axis. Mol Med, 2023; 29(1):91; doi: 10.1186/s10020-023-00694-7

49.

Song

, Sun

, Tu

, et al. WTAP boosts lipid oxidation and induces diabetic cardiac fibrosis by enhancing AR methylation. iScience, 2023a;26(10):107931; doi: 10.1016/j.isci.2023.107931

50.

Song

, Chen

, Qin

, et al. Oxidative stress drives vascular smooth muscle cell damage in acute Stanford type A aortic dissection through HIF-1alpha/HO-1 mediated ferroptosis. Heliyon, 2023b;9(12):e22857; doi: 10.1016/j.heliyon.2023.e22857

51.

Tang

, Chen

, Zhang

, et al. Vascular smooth muscle cells phenotypic switching in cardiovascular diseases. Cells, 2022; 11(24):4060; doi: 10.3390/cells11244060

52.

Tang

, Mei

, Wang

, et al. LncRNA GAS5 regulates vascular smooth muscle cell cycle arrest and apoptosis via p53 pathway. Biochim Biophys Acta Mol Basis Dis, 2019; 1865(9):2516–2525; doi: 10.1016/j.bbadis.2019.05.022

53.

Tian

, Cai

, Yang

, et al. YTH N(6)-methyladenosine RNA binding protein 1 inhibits smooth muscle cell phenotypic modulation and neointimal hyperplasia. Cells, 2025; 14(3):160; doi: 10.3390/cells14030160

54.

, Song

, Zhou

, et al. METTL3 boosts mitochondrial fission and induces cardiac fibrosis by enhancing LncRNA GAS5 methylation. Pharmacol Res, 2023; 194:106840; doi: 10.1016/j.phrs.2023.106840

55.

Wang

, Wang

, Li

, et al. m6A writer WTAP targets NRF2 to accelerate bladder cancer malignancy via m6A-dependent ferroptosis regulation. Apoptosis, 2023; 28(3–4):627–638; doi: 10.1007/s10495-023-01817-5

56.

Wang

, Wang

, Sun

, et al. Mechanisms of ferroptosis and glucagon-like peptide-1 receptor agonist in post-percutaneous coronary intervention restenosis. Mol Cell Biochem, 2025; 480(3):1465–1480; doi: 10.1007/s11010-024-05118-6

57.

Wang

, Zhang

, Gao

, et al. Lipocalin-2 promotes CKD vascular calcification by aggravating VSMCs ferroptosis through NCOA4/FTH1-mediated ferritinophagy. Cell Death Dis, 2024; 15(11):865; doi: 10.1038/s41419-024-07260-x

58.

Worssam

, Jorgensen

. Mechanisms of vascular smooth muscle cell investment and phenotypic diversification in vascular diseases. Biochem Soc Trans, 2021; 49(5):2101–2111; doi: 10.1042/BST20210138

59.

, Xu

, Ma

, et al. The mechanisms of ferroptosis and its role in atherosclerosis. Biomed Pharmacother, 2024; 171:116112; doi: 10.1016/j.biopha.2023.116112

60.

Yang

, Luo

, Yi

, et al. The epigenetic regulatory mechanisms of ferroptosis and its implications for biological processes and diseases. MedComm (2020), 2023; 4(3):e267; doi: 10.1002/mco2.267

61.

Yang

, Zhou

, Li

, et al. The NEXT complex regulates H3K27me3 levels to affect cancer progression by degrading G4/U-rich lncRNAs. Nucleic Acids Res, 2025; 53(4):gkaf107; doi: 10.1093/nar/gkaf107

62.

Yang

, Li

, Tian

, et al. Myeloid-derived growth factor suppresses VSMC dedifferentiation and attenuates postinjury neointimal formation in rats by activating S1PR2 and its downstream signaling. Acta Pharmacol Sin, 2024; 45(1):98–111; doi: 10.1038/s41401-023-01155-x

63.

Yin

, Ge

, Yuan

, et al. NEAT1 regulates VSMC differentiation and calcification in as long noncoding RNA NEAT1 enhances phenotypic and osteogenic switching of vascular smooth muscle cells in atherosclerosis via scaffolding EZH2. Am J Physiol Cell Physiol, 2024a;326(6):C1721–C1734; doi: 10.1152/ajpcell.00587.2023

64.

Yin

, Zhang

, Shen

, et al. Regulated vascular smooth muscle cell death in vascular diseases. Cell Prolif, 2024b;57(11):e13688; doi: 10.1111/cpr.13688

65.

, Hou

, Xiang

, et al. Arsenic trioxide activates yes-associated protein by lysophosphatidic acid metabolism to selectively induce apoptosis of vascular smooth muscle cells. Biochim Biophys Acta Mol Cell Res, 2022; 1869(4):119211; doi: 10.1016/j.bbamcr.2022.119211

66.

, Wu

, Hao

, et al. Ginger protects against vein graft remodeling by precisely modulating ferroptotic stress in vascular smooth muscle cell dedifferentiation. J Pharm Anal, 2025; 15(2):101053; doi: 10.1016/j.jpha.2024.101053

67.

Zhang

, Kuang

, Xiong

, et al. Transcription factor and microRNA co-regulatory loops: Important regulatory motifs in biological processes and diseases. Brief Bioinform, 2015; 16(1):45–58; doi: 10.1093/bib/bbt085

68.

Zhang

, Zheng

, Zhang

, et al. Nanoparticles targeting OPN loaded with BY1 inhibits vascular restenosis by inducing FTH1-dependent ferroptosis in vascular smooth muscle cells. Biomaterials, 2024; 309:122613; doi: 10.1016/j.biomaterials.2024.122613

69.

Zhong

, Xu

, Tang

, et al. LncRNA growth arrest specific 5 promotes glucose metabolism reprogramming via the IGF2BP1/SIX1 axis and inhibits ferroptosis of endothelial progenitor cells via the miR-23a-3p/SLC7A11 axis in coronary heart disease. Anatol J Cardiol, 2025; 29(4):181–192; doi: 10.14744/AnatolJCardiol.2025.5042

70.

Zhu

, Gong

, Shen

, et al. Total panax notoginseng saponin inhibits vascular smooth muscle cell proliferation and migration and intimal hyperplasia by regulating WTAP/p16 signals via m(6)A modulation. Biomed Pharmacother, 2020; 124:109935; doi: 10.1016/j.biopha.2020.109935

Epitranscriptomic Control of Vascular Smooth Muscle Cell Ferroptosis by WTAP in the Pathogenesis of Vascular Restenosis

Abstract

Aims:

Results:

Innovation:

Conclusion:

Keywords

Introduction

Results

WTAP overexpression ameliorates vascular restenosis and inhibits ferroptosis

WTAP overexpression inhibits PDGF-BB-induced VSMC abnormal proliferation and ferroptosis

WTAP stabilizes lncRNA GAS5 expression via m6A modification

GAS5 knockdown partially reverses inhibited VSMC abnormal proliferation and ferroptosis

GAS5 binds to EZH2 to block EZH2-mediated H3K27me3 modification of the IRF4 promoter and promote IRF4 expression

IRF4 knockdown partially restores VSMC abnormal proliferation and ferroptosis

IRF4 promotes FTH1 transcription and expression

GAS5 knockdown partially aggravates vascular restenosis in BI rats

Discussion

WTAP-centered epitranscriptomic regulation of VSMC ferroptosis

WTAP: a multifaceted regulator in vascular physiology and pathology

The GAS5-EZH2-IRF4-FTH1 axis: downstream molecular network analysis of ferroptosis inhibition

Epitranscriptome regulation in vascular biology and ferroptosis

The pathological interaction between VSMC proliferation and ferroptosis and its clinical translational significance

Limitation and future directions

Conclusion

Materials and Methods

Ethics statement

Experimental animals

BI rat model establishment

Histopathological detection

Cell culture and treatment

CCK-8 assay

ROS detection

Detection of Fe2+, MDA, and GSH

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Western blot

EdU assay

Bioinformatics analysis

Total m6A detection and MeRIP assay

RIP

RNA stability assay

FISH

Nuclear and cytoplasmic fractionation

RNA pull-down assay

ChIP

Dual-luciferase reporter assay

Statistical analysis

Authors’ Contributions

Footnotes

Author Disclosure Statement

Funding Information

Data Availability Statement

Abbreviations

References

Detection of Fe²⁺, MDA, and GSH