Expression of the Alzheimer’s Disease Mutations AβPP695sw and PSEN1M146I in Double-Transgenic Göttingen Minipigs

Abstract

Mutations in the amyloid-β protein precursor gene (AβPP), the presenilin 1 gene (PSEN1) or the presenilin 2 gene (PSEN2) that increase production of the AβPP-derived peptide Aβ₄₂ cause early-onset Alzheimer’s disease. Rodent models of the disease show that further increase in Aβ₄₂ production and earlier brain pathology can be obtained by coexpressing AβPP and PSEN1 mutations. To generate such elevated Aβ₄₂ level in a large animal model, we produced Göttingen minipigs carrying in their genome one copy of a human PSEN1 cDNA with the Met146Ile (PSEN1M146I) mutation and three copies of a human AβPP695 cDNA with the Lys670Asn/Met671Leu (AβPPsw) double-mutation. Both transgenes were expressed in fibroblasts and in the brain, and their respective proteins were processed normally. Immunohistochemical staining with Aβ₄₂-specific antibodies detected intraneuronal accumulation of Aβ₄₂ in brains from a 10- and an 18-month-old pig. Such accumulation may represent an early event in the pathogenesis of Alzheimer’s disease.

Keywords

Alzheimer’s disease amyloid porcine model presenilin transgenic

INTRODUCTION

Many human diseases with a genetic etiology have been replicated in genetically modified animals and rodent models are dominating this area of translational medicine. But for some diseases, translation to the clinic has failed as rodent models did not faithfully recapitulate key aspects of the disease phenotype. A porcine model may therefore be an attractive alternative [1], and development of porcine models of cystic fibrosis as well as hypercholesterolemia and atherosclerosis are prominent examples [2 –7]. Similarly, porcine models of Alzheimer’s disease (AD) may be more representative of the human condition. AD is the most common cause of dementia and, being slowly progressive, efforts to prevent it depend on understanding early events in its pathogenesis. Mutations in the amyloid-β protein precursor (AβPP) or the presenilin 1 or 2 proteins (PSEN1/PSEN2) that increase production of the AβPP-derived proteolytic fragment Aβ₄₂ cause autosomal dominant early-onset AD [8], whereas the etiology of the common late-onset form of AD is complex with 20 or more susceptibility loci [9]. Nevertheless, the two forms of AD share similar clinical, biochemical, and neuropathological manifestations, and it is widely believed that an imbalance in the brain between production and clearance of Aβ₄₂ is the initial pathogenic event in both forms of AD [10].

Transgenic mouse models have shown that marked increase in Aβ₄₂ production can be obtained by combining mutant human AβPP and PSEN1 which results in accumulation of Aβ₄₂ within neurons and, subsequently, in extraneuronal amyloid deposits. These deposits are similar to those found in AD, but whether they are preceded by intraneuronal Aβ₄₂ in human pathology is still a matter of dispute [11]. Other neuropathological hallmarks of AD such as intraneuronal neurofibrillary tangles of hyperphosphorylated protein tau associated with widespread neuronal death do not develop in these mouse models [12].

By coexpressing mutant human AβPP (AβPPsw) and PSEN1 (PSEN1ΔE9) in the rat Cohen et al. [13] were able to replicate more key features of the AD phenotype, including tau pathology and frank neuronal loss, but also this and other rat models remain incomplete models as they do not develop the characteristic neurofibrillary tangles [14]. Thus, the pathogenic important connection between Aβ accumulation and tau pathology remains largely unknown.

We decided to try to model AD in the domestic pig which, compared to rodents, has higher anatomical, physiological, and genetic similarities to humans, including the AβPP, PSEN1, and tau genes. In particular, human and porcine AβPP molecules share identical secretase cleavage sites, identical Aβ amino acid sequence, and 3R tau isoform involved in AD tau pathology is present in the pig, but not in rodents [15]. We have produced pigs carrying in their genome the human AβPP695sw and PSEN1M146I transgenes, each of which is driven by a CMV-enhanced UbiC promoter. Based on results from similar mouse models we expected this transgene combination to increase Aβ₄₂ production and accelerate its deposition in the brain [16 –18].

Here, we describe the generation of such double-transgenic Göttingen minipigs and report the first pathological findings in the brain of a 10- and an 18-month-old pig.

MATERIALS AND METHODS

Vector construction

The AβPP695sw SB transposon plasmid was constructed from the floxed-Ei-Ubi-PSEN1M146I plasmid [19]. First the LIR element was PCR amplified using primer: 5′–tagtgaattcagatctgatatc-3′ and 5′-ggatGAGCTCTCGCGActgtttaaaggcacagtcaact-3’ and the pSBT/SV40-FGIP plasmid as template [20]. The LIR amplicon was inserted in the floxed-Ei-Ubi-PSEN1M146I plasmid using EcoRI/SacI. AβPP695sw was PCR amplified using primer 5′-gatcttaattaagccaccatgctgcccggtttggcactgctc-3′ and 5′-gatcatgcatctagttctgcatctgctcaaag-3′ and the pPDGFβAβPP695sw plasmid as template [21]. The AβPP695sw amplicon was inserted in LIR- pSBT/floxed-Ei-Ubi-PSEN1M146I using pacI/NsiI. Hereby replacing PSEN1M146I with AβPPsw695 and creating LIR-floxed-Ei-Ubi-AβPP695sw. The element composing the four polyadenylation signals (one βGH PA and three SV40 PA signals) was synthesized by GenScript and inserted in LIR-floxed-Ei-Ubi-AβPP695sw using NsiI/NotI creating LIR- pSBT/floxed-Ei-Ubi-AβPP695sw_4xPA. RIR was cut out from pSBT/Ubi-GIN [19] using AscI/SbfI and inserted into LIR- floxed-Ei-Ubi-AβPP695sw_4xPA to create the AβPP695sw SB transposon plasmid called pSBT/floxed-Ei-Ubi-AβPP695sw_4xPA (Fig. 2A). The pSBT/SV40-cHS4-Neo plasmid was created by inserting the SV40 promoter and the neomycin gene in pSBT/cHS4.Ubi-GIN.cHS4 [20]. The SV40 promoter was amplified using primer: 5’- gccattaattaaccagctgtggaatgtgtgtcagttagggtgtgg-3'and 5′- ccgtctaggcctccaaaaaagcctcc-3’ and inserted using pacI/AvrII. The neomycin gene was amplified using primer:

5′-gatccctaggcttttgcaaagatcgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacg-3′ and 5′- tgacgctagcccatagagcccaccgcatc-3′ and inserted using AvrII/NheI. The SB100 minicircles were produced using Sbf1 digestion of the SB100_pCMV(CAT)T7-SB100 plasmid as described [19, 22].

Transfection of fibroblasts to generate AβPP695sw/PSEN1M146I double-transgenic pigs

Fibroblasts were cultured from ear biopsies of newborn PSEN1M146I Göttingen minipig no. 495 (female). The cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) with 15% fetal calf serum (Sigma-Aldrich, batch F7524; 042M3396) to 50% confluence and passaged for further expansion prior to freezing of aliquots. PSEN1M146I fibroblasts were seeded at 25% confluence in a 60 cm² dish in 11 ml with basic fibroblast growth factor (bFGF). The cells were transfected using 4900 ng of pSBT/floxed-Ei-Ubi-AβPP695sw_4xPA and 700 ng of pSBT/SV40-cHS4-Neo and 28 ng SB100 minicircles. We favor the use of minicircles as random integration of minicircles into the genome will result in disruption of the gene in contrast to random plasmid integration where breakage in the plasmid backbone could result in constitutive expression of SB100. The DNA was diluted in 600 μl serum free DMEM and 18μl Xtreem9 was used in the reaction mixture. On the following day, the cells were washed with PBS and 33% and 10% of the cells were transferred to separate 60 cm² dish and subsequently cultured in G418-containing medium (0.75μg/ml) for 12 days. bFGF was used as a supplement at a final concentration of 7 ng/ml. bFGF supplement medium was used at all-time except when the cells were under G418 selection and five days prior to somatic cell nuclear transfer (SCNT). Selected colonies were pooled and grown for 9 days prior to SCNT by handmade cloning.

SCNT by handmade cloning

The procedure was done essentially as previously described [21, 23]. The pigs were housed and handled according to Danish law on genetically modified animals and the experiments were conducted according to the Danish Animal Experiments Inspectorate (license no. 2006-561/1156 and 2009-561/1733).

Southern blotting

Southern blotting was carried out as described previously [21]. Two fragments generated by KpnI/XhoI (857bp) and SacI/NsiI (505bp) digestion of the pSBT/floxed-Ei-Ubi-AβPP695sw_4xPA plasmid were used as probes to reveal the presence of AβPP695sw transgenes in the AβPP695sw/ PSEN1M146I pigs (Fig. 2A). The DNA isolated from the AβPP695sw/PSEN1M146I pigs was digested with MfeI.

Long distance inverse (LDI)-PCR

LDI-PCR has been described previously [21]. The following primer pairs were used in the BspHI LDI-PCR to reveal the transposon insertion site (TIS) in chromosome 4:5′- ggaagaggtggttcgagttcc 3′ and 5′-gaggtggttcgagttcctac -3′ (Fig. 2A primer pair c), 5′-agaagggcatcacttacaaa-3′ and 5′-gggttcagccagcaggccag-3′ (Fig. 2A primer pair b). The following primer pairs were used in the NsiI LDI-PCR to reveal the TIS in chromosome 15 and the unannotated region: 5′-ccgaggactgaccactcgac -3′ and 5′-tgtggtggaggttgacgc-3′ (Fig. 2A primer pair d), 5′-gttatgtaacgcggaactcc-3′ and 5′-agatgtcctaactgacttgcca -3′ (Fig. 2A primer pair a).

Cell culture and γ-secretase inhibition

Fibroblasts from ear biopsies of wt Göttingen minipig and AβPP695sw/PSEN1M146I double-transgenic Göttingen minipigs nos. 592 and 590 were grown in DMEM with 15% fetal bovine serum, 1% penicillin/streptomycin, 1% glutamine, and 0.01% bFGF to 90% confluence in 75 cm² flasks. The cells were rinsed with PBS, treated with 1 ml 0.05% Trypsin/EDTA, and 2.5×10⁶ cells transferred to separate flasks and cultured for 24 h. The cells were rinsed with PBS and cultured in 2/3μM γ-secretase inhibitor X (Calbiochem) for another 24 h. Optimal inhibitor concentration was determined from a dilution series.

Western blotting and ELISA assay

For immunoblotting, cells were either sonicated in lysis buffer (0.32 M sucrose, 10μg/ml aprotinin, 1 mg/ml soya bean trypsin inhibitor) and EDTA-free protease inhibitor cocktail or cells were solubilized with RIPA buffer (150 mM NaCl, 50 mM Tris, 1% Triton X100, 0.5% deoxycholate, 0.1% SDS, 1 mM EDTA pH 7.6). Protein quantitation was performed with Bradford method. Porcine brain samples were homogenized in buffered sucrose solution (20 mM HEPES pH 7.4, 0.25 M sucrose, 1 mM EDTA, and 1 mM EGTA), and a protease inhibitor cocktail, followed by 1.0% NP-40 lysis buffer to examine AβPP and PSEN1 level. The primary antibodies used in this study were as follows: human-specific mouse monoclonal antibody (NT1, gift from Paul M. Mathews) the epitope for which is the residues 41–49 of human PSEN1 where the human and porcine PSEN1 show little homology [24]; rabbit polyclonal antibody Ab14 to PSEN1-NTF which recognizes a peptide epitope representing the first 23 residues of human PSEN1 that are identical in human and porcine PSEN1; mouse monoclonal antibody C1/6.1 directed to the C-terminal domain of AβPP where the residues are identical in human and porcine AβPP [25]. BioRad 16.5% MiniPROTEAN Tris-Tricine gel was used to separate bands (C83 and C99, Fig. 5) in 10–15 kDa range. Aβ_1 - 40 (Aβ₄₀) and Aβ_1 - 42 (Aβ₄₂) levels in homogenized brain tissues were measured by enzyme-linked immunosorbent assay (ELISA) (Invitrogen) according to the manufacturer’s protocol. Briefly, brains were homogenized in 8x (w/v) buffer containing 50 mM Tris-HCl and 5 M guanidine-HCl for total Aβ_40/42 quantification.

Brain tissue preparation and immunohistochemical staining

Brains were recovered and dissected immediately after the pigs were euthanized. The right hemispheres were immersed in a 4% formaldehyde solution, whereas the left hemispheres were dissected and tissue samples for biochemical studies were snap frozen in liquid nitrogen. Following fixation, each right hemisphere was cut in 3-4 mm thick coronal slabs containing cortex, thalamus, basal ganglia and the hippocampus, whereas the cerebellum and the brainstem were cut in sagittal and horizontal slabs. All slabs were embedded in paraffin, and 5μm thick paraffin sections cut and placed onto glass slides.

Tissue samples were processed as previously described [26, 27]. In brief, 5μm thick paraffin sections were deparaffinized in xylene, followed by rehydration in a series of ethanol. After H₂O₂ treatment to block endogenous peroxidases, sections were boiled in 0.01 M citrate buffer for antigen retrieval, followed by 3 min incubation in 88% formic acid. Non-specific binding sites were blocked by treatment with skim milk and fetal calf serum in PBS, prior to the addition of the primary antibody Aβ₄₂ (1:2,500; Synaptic Systems, rabbit polyclonal specific for the C-terminus of Aβ₄₂). The corresponding biotinylated secondary anti-rabbit antibody (1:200) was purchased from DAKO (Glostrup, Denmark). Staining was visualized using the ABC method, with a Vectastain kit (Vector Laboratories, Burlingame, USA) and diaminobenzidine (DAB) as chromogen. Counterstaining was carried out with hematoxylin. Bright field images of DAB-immunostained tissue were acquired using a Nikon Eclipse 80i photomicroscope. Staining was also performed using another rabbit polyclonal anti-Aβ₄₂ antibody specific for the C-terminus of Aβ₄₂ (1:100; ab10148, Abcam, Cambridge, UK).

RESULTS

PSEN1M146I-expressing founder pig

Using recombinase-mediated cassette exchange and SCNT, we previously obtained a litter of cloned male piglets transgenic with four acceptor loci (A,B,C,D) and one copy of the human PSEN1M146I cDNA transgene integrated into the transcriptionally active acceptor locus B (abbreviated the B cassette, Supplementary Fig. 3) [19]. Total RNA was extracted from fibroblasts from one such pig (no. 540), cDNA was synthesized and sequenced and the presence of the human PSEN1M146I sequences was confirmed, including the G to A missense mutation at third position of codon146 changing specificity from Methionine to Isoleucine (data not shown). The PSEN1 protein is synthesized as a 50 kDa precursor with nine transmembrane domains. During maturation, where it interacts with the proteins Nicastrin, Aph-1, and Pen-2 in a stoichiometric fashion, PSEN1 is cleaved into a 30 kDa amino-terminal fragment (NTF) and a 20 kDa carboxy-terminal fragment (CTF), and the two fragments form a heterodimer which provides the catalytic subunit of the γ-secretase complex [28]. In Fig. 1, expression and maturation of the human PSEN1M146I protein in the porcine brain were studied by western blotting of tissues from the hippocampus and cerebral cortex of two 6-month-old genetically identical littermates of no. 540, i.e., nos. 504 and 505, and compared with the same tissues from an 18-month-old non-transgenic pig (wt) and the HEK cells stably expressing the AβPP695sw transgene (WT2). Using an antibody which recognizes both the human and porcine N-terminal fragment of PSEN1, Fig. 1a shows that almost all of the endogenous porcine and the transgenic human 50 kDa full-length PSEN1 has been cleaved into a strong band between 30 and 36 kDa representing the NTF. The human PSEN1 transgene, therefore, appears to be well tolerated in the porcine brain cells and almost all of the protein molecules may contribute to the γ-secretase activity. The intensity of the NTF band in lanes 504 and 505 is at least double of that in the wt lane indicating that half or more of the γ-secretase complexes contain human mutated PSEN1. The robust expression and normal cleavage of the human mutated PSEN1 in the transgenic pigs 504 and 505 was confirmed with an antibody specific of the human NTF (Fig. 1b).

A F1 litter was produced by crossing pig 540 with a wt sow, and one of the littermates, pig 495, was transgenic of only the B cassette containing the PSEN1M146I transgene. With LDI-PCR it was possible to map the B cassette to LINE sequences on chromosome 1 at 142.8 Mbp within band q18 (data not shown). This pig 495 became founder pig and its fibroblasts were used to generate double-transgenic pigs (Supplementary Figure 3).

Generation of pigs co-expressing human PSEN1M146I and AβPP695sw transgenes

Fibroblasts from pig 495 were isolated and made transgenic of a human AβPP695sw cDNA containing the Lys670Asn/Met671Leu (“Swedish”) double mutation. Fibroblasts colonies with expression of the AβPP695sw protein and increased production of Aβ₄₀ and Aβ₄₂ proteolytic fragments (Supplementary Figure 1a–c) were selected and used for SCNT. Three pigs (nos. 590, 591, 592) were born alive, had normal birth weight and no visible abnormalities. But as 590 failed to thrive, it was euthanized two days later, and at autopsy, a persistent ductus arteriosus was discovered. The brain was recovered and processed immediately and used for further studies.

Southern blotting (Fig. 2) of fibroblast DNA from the three pigs using human AβPP probes showed that pigs 591 and 592 are genetically identical with respect to transgene insertion as they share the banding pattern of three independent genome insertions of individual copies of the AβPP695sw transgene. These pigs, therefore, originate from the same cell colony while pig 590, having a different banding pattern with four independent insertions, must have originated from another of the pooled cell colonies used for SCNT.

Figure 3 shows western blots of fibroblasts from the three pigs, 590, 591, and 592. Using the same PSEN1 antibodies as in Fig. 1a and b, the blots in Fig. 3a and b show, as expected, that the expression level and processing of the human PSEN1M146I transgene protein are the same in all three pigs and similar to the pattern of pigs 504 and 505, shown in Fig. 1. The presence of a stronger PSEN1 full-length band in fibroblasts compared to brain tissues where it is virtually absent (Fig. 1) indicates that more PSEN1 protein matured in brain tissues. Figure 3c shows the antibody C1/6.1 recognizing the C-terminal end of both human, porcine, and rodent AβPP. The lane with WT2 cells is positive control containing extract from HEK cells stably overexpressing AβPP695sw. The western blotting shows that AβPP695sw was highly expressed in fibroblasts from pig 590 and to a lower degree in fibroblasts from pigs 591 and 592. Full-length AβPP located in the membrane undergoes α-secretase cleavage (non-amyloidogenic pathway) creating the C83 C-terminal fragment or β-secretase cleavage (amyloidogenic pathway) creating the C99 C-terminal fragment. Both fragments are subsequently cleaved by γ-secretase and the smaller C-terminal fragment AICD (AβPP intracellular domain) is liberated. The C99/C83 and the AICD bands are strong in lane 590 and less pronounced in lanes 591 and 592, but clearly stronger than the bands in the lane representing non-transgenic (wt) pig, where the AICD band is not discernable (Fig. 3c). This banding pattern shows that the processing of porcine AβPP was similar to that of human AβPP and that the transgenic AβPP695sw protein was processed normally in the pig. Due to the presence of the Swedish mutation it was expected that a greater proportion of the increased production of the AICD fragment resulted from the sequential β- and γ-secretase cleavages of AβPP695sw.

To confirm this prediction, we performed western blotting and ELISA analysis of three independent cell cultures of fibroblasts from pig 592 and wt pig, and the results are shown in Fig. 4. The bands corresponding to full-length AβPP, C99/C83, and AICD are stronger in the transgenic pig 592 as compared to the wt pig (Fig. 4a) and are consistent with the results shown in Fig. 3c. The low full-length AβPP signal relative to the CTF signal in fibroblasts compared to hippocampal tissue from these animals (see later) and to HEK293 cells overexpressing AβPP695sw (lane WT2 cells) was unexpected, but was found repeatedly. The extent to which β-secretase cleavage contributes to the intensity of the AICD band in the 592 lanes is difficult to judge based on the blot as the C99 and C83 bands are not well resolved. However, production of Aβ₄₀ and Aβ₄₂ fragments requires β-secretase cleavage before γ-secretase cleavage of AβPP. The ELISA results in Fig. 4b and c demonstrate that fibroblasts from pig 592 produced more Aβ₄₀ and Aβ₄₂ than did fibroblasts from the wt pig, which indicates that some of the expressed AβPP695sw protein was processed via the amyloidogenic pathway. This was supported by results from western blotting of cell extracts from fibroblasts subjected to γ-secretase inhibition (Fig. 5). The C83 and C99 fragments are hardly discernable in untreated cells as γ-secretase cleavage has liberated the AICD from most of the fragments. In treated cells, however, both fragments appear as distinct bands in cells from transgenic pig 592, and only a weaker C83 band appears in wt cells (Fig. 5a). The stronger C83 band in 592 cells, as compared to wt cells, could indicate that some of the transgenic AβPP695sw protein molecules were cleaved by α-secretase whereas the presence of a distinct C99 band, absent from the wt lane, shows that AβPP695sw was also cleaved by β-secretase, in accord with the presence of the Swedish mutation. A similar inhibition experiment using fibroblasts from pig 590 with high expression of AβPP695sw is shown in Fig. 5b.

AβPP695sw expression and processing in hippocampal tissue of transgenic pigs 592

To produce more high-expressing and low-expressing piglets, we used skin fibroblasts from piglets 590 and 592, respectively, for SCNT. The established pregnancies resulted in a litter of two live born, but weak, recloned 590 piglets, and a litter of seven live born and nine still born recloned 592 piglets. Again, the 590 piglets failed to thrive. One of them contracted pneumonia, was euthanized at 2 days old, and its brain was recovered and processed immediately. The other 590 piglet was found dead in the pen at seven days of age, and an autopsy was performed but revealed no definitive cause of death. Subsequent attempt to reclone and produce viable 590 piglets also failed.

Figure 6 shows western blots of brain extracts from the hippocampal region of a 3-month-old pig 592 (reclone), a 10-month-old pig 592 (reclone), an 18-month-old pig 592 (original), and a 3-month-old non-transgenic (wt) pig. The intensities of the bands corresponding to full-length AβPP in Fig. 6a appear similar in the pig 592 and the wt pig lane and clearly lower than in HEK 293 cells stably overexpressing AβPPsw (lane WT2 cells). Longer exposure was necessary in order to visualize the C99/C83 fragments, which also appeared to be similar in intensity among the pigs, but the AICD fragment did not produce a discernable band (Fig. 6b). This lack of detectable contribution of AβPP695sw in brain tissue is in contrast to the results from fibroblasts, as shown in Figs. 3c and 4a, and could be due to low level AβPP695sw mRNA and protein expression in the brain. Our real-time quantitative PCR (RT-qPCR) results support this notion. We used the same tissue samples of the hippocampal regions of the pigs and found that the highest ratio between AβPP695sw mRNA and total porcine AβPP mRNA was 1:4 in the 18-month-old pig 592, 1:10 in the 10-month-old pig 592, and even less in the 3-month-old pig 592 (Supplementary Figure 2).

Quantification of Aβ₄₀ and Aβ₄₂ in hippocampal tissue from the 3-month-old non-transgenic (wt) pig, the 10-month-old pig 592, and the 18-month-old pig 592 was performed by ELISA measurements and the results are listed in Table 1. While the Aβ₄₀ level is fairly constant, the Aβ₄₂ level is about 1.5 fold higher in the 18-month-old pig 592 than in the 10-month-old pig 592, and about 2.5 fold higher than in the 3-month-old wt pig. Accordingly, the total amount of Aβ increased, and the Aβ₄₂/Aβ₄₀ ratio increased from 0.63 in the wt pig to 1.71 and 2.13 in the 10-month-old and 18-month-old pigs 592, respectively. Higher Aβ₄₂ production is expected in the brains of pig 592 due to the expression of the human PSEN1M146I mutation, and the modest increase in the Aβ₄₂/Aβ₄₀ ratio could reflect differences in clearance efficiency in the brain of Aβ₄₂ and Aβ₄₀ and time-dependent accumulation of Aβ₄₂ [29].

Immunohistochemical studies of paraffin sections from wt and transgenic porcine brains

Immunohistochemical staining showed varying degrees of intraneuronal accumulation of Aβ₄₂ (Fig. 7a–f). Only faint background staining in the wt animals (Fig. 7a,e). This background staining was present in all animals. Additional intraneuronal staining was seen in a number of neurons in the AβPP695sw/PSEN1M146I double-transgenics (arrows, Fig. 7c,d,g,h). This staining was seen as cytoplasmic staining including the neurites, exemplified here in the dentate hilus (Fig. 7g) and the hippocampal CA1 (Fig. 7h). Such staining was not seen in the PSEN1M146I transgenics. No obvious increase was seen with age and no extracellular material was encountered. The staining was carried out in two laboratories using two different antibodies specific of the C-terminus of Aβ₄₂.

DISCUSSION

It has been hypothesized that intraneuronal accumulation of Aβ is the first step in the pathogenic cascade leading to AD [30 –32]. Accordingly, studies of human brain tissue have suggested that intraneuronal Aβ accumulation is an early event in AD pathogenesis [33, 34]. Early intraneuronal Aβ accumulation before extracellular deposition or other pathological changes occur has also been reported in transgenic mice including single-transgenic models carrying AβPP with Swedish mutation [35] or AβPP with Swedish and Arctic (E693G) mutations [36, 37]; double-transgenic models carrying AβPP with Swedish and London (V717I) mutations and PSEN1 with the M146L mutation [38], or AβPP with Swedish, London and Dutch (E693Q) mutations and PSEN1 with the M146L mutation [39], or AβPP with Swedish, London, and the I716V mutations and PSEN1 with the M146L and L286V mutations (5XFAD mouse) [40], or AβPP with Swedish and London mutations and PSEN1 knock-in mutations M233T and L235P [41 –43], and a triple transgenic model carrying AβPP with Swedish mutation, PSEN1 with the M146V mutation, and tau with the P301L mutation [44]. It was shown in several of these models where antibodies specific of the C-terminal end of Aβ₄₂ was employed that Aβ₄₂ had accumulated in the Aβ-positive neurons [35 , 45] and that Aβ₄₂ accumulation was associated with synaptic pathology [33] and correlated with neuronal loss [41, 45]. Furthermore, early Aβ₄₂ accumulation in neurons has been described in AD-vulnerable brain regions [33] and in younger Down syndrome patients [34, 46]. However, other studies of AD patients, Down syndrome patients, and control subjects have suggested that intraneuronal Aβ immunoreactivity merely reflects normal metabolism of AβPP [47].

We generated double-transgenic Göttingen minipigs in an attempt to produce intraneuronal Aβ₄₂ accumulation in a large animal and study the neuropathological effect. To this end, we introduced the human AβPP695sw transgene into the genome of fibroblasts from a transgenic Göttingen minipig expressing the human PSEN1M146I transgene in fibroblasts and brain tissues (Figs. 1 and 2; [19]). Subsequent cloning of such cells also expressing AβPP695sw (Supplementary Figure 1) produced double-transgenic pigs expressing both transgenes at appreciable levels (Figs. 3 and 4), and fibroblasts from double-transgenic pig 592 were used for re-cloning to produce more pigs 592.

Inhibition of γ-secretase cleavage showed that a significant fraction of AβPP695sw protein underwent β-secretase cleavage in accord with the presence of Swedish mutation (Fig. 5). As expected, the sequential β-γ cleavage produced more Aβ₄₀ and Aβ₄₂ fragments as compared to wt fibroblasts (Fig. 4b,c). By contrast, AβPP695sw could not be detected on western blots of hippocampal tissue from pig 592 (Fig. 6). The explanation is most likely low-level expression as RT-PCR results indicated a 1:4 ratio in this tissue between AβPP695sw mRNA and total porcine AβPP mRNA (Supplementary Figure 2). Nevertheless, ELISA quantification of Aβ₄₂ and Aβ₄₀ in the hippocampal tissue (Table 1) detected a slight increase in total Aβ and in the Aβ₄₂/Aβ₄₀ ratio in the double-transgenics, which is consistent with the predicted combined effect of AβPP Swedish and PSEN1 M146I mutations [17 , 48–50]. However, the increase in Aβ₄₂ could be driven mainly by the PSEN1M146I transgene effect on endogenous AβPP, but with immunohistochemical staining it was possible to detect the contribution of the AβPP695sw transgene.

In our immunohistochemical stainings of brain sections from age matched wt, PSEN1M146I, and AβPP695sw/PSEN1M146I pigs, we used two different antibodies specific of the C-terminal end of Aβ₄₂, and the results are shown in Fig. 7. Staining carried out in two laboratories showed immunoreactivity located in the neuronal cytoplasm throughout the brain. There was no staining of glial cells or in the extracellular space. The strongest staining reaction was seen in the double-transgenics, aged 10 and 18 months, but we did not see an increase in staining intensity between the two time-points as the ELISA measurements suggested. Faint intraneuronal staining was also observed in the PSEN1M146I transgenics, but due to the presence of slight non-specific background staining in all animals the specificity of this faint intraneuronal staining was difficult to interpret. However, the intraneuronal staining in the brains of the double-transgenics aged 10 and 18 months was persuasive and reproducible in both labs. Even though the AβPP695sw level was low compared to porcine AβPP level the staining shows that expressing this level of AβPP695sw on top of the PSEN1M146I expression is enough to produce the first sign of pathology at an age around 10 months.

Aβ accumulation in neurons of mouse models has been reported at ages varying between 2 and 8 months [35–37 , 44], the earliest being 1.5 months in the 5XFAD mouse [40]. The extra time period required to develop extracellular Aβ deposits is typically 4–6 months [34–36 , 43] but varies from 2 weeks in the 5XFAD model [40] to 11 months in the model carrying AβPP with Swedish, Dutch, London mutations and PSEN1 with the M146L mutation [39]. Even slower progression of pathology was reported in a knock-in mouse model with endogenous expression level of murine AβPP in which the Aβ sequence had been humanized and the Swedish and the Beyreuther/Iberian mutations introduced. While the Swedish mutation increased total Aβ₄₀ and Aβ₄₂ and the Beyreuther/Iberian mutation increases the Aβ₄₂/Aβ₄₀ ratio, no cortical amyloidosis was observed in homozygous mice and in heterozygous mice before 6 and 24 months of age, respectively [51]. To predict from these time intervals at what age our porcine model carrying human AβPP695sw and PSEN1M146I mutations will develop plaque-like extracellular Aβ deposits becomes even more uncertain as the time intervals has to be translated into an animal with a six to seven times longer life span.

Footnotes

ACKNOWLEDGMENTS

This work was supported by the Lundbeck Foundation grants nos. R34-A3948 and R108-A10861, Canadian Institute of Health Research (TAD-117950), Alzheimer’s Society of Ontario. We thank Tracey Flint for help with gene mapping, Karen Lykkegaard Christensen for technical assistance with histology, Tina Fuglsang Daugaard for technical assistance with RT-qPCR, Janne Adamsen, Ruth Kristensen, Anette M Pedersen, and Klaus Villemoes for technical assistance regarding embryo production. JEJ was supported by a post.doc. fellowship from the Danish Agency for Science, Technology and Innovation, no. 11-105224.

Author’s disclosures available online ().

Appendix

References

Flisikowska

, Kind

, Schnieke

(2014) Genetically modified pigs to model human diseases. J Appl Genet 55, 53–64.

Rogers

, Hao

, Rokhlina

, Samuel

, Stoltz

, Li

, Petroff

, Vermeer

, Kabel

, Yan

, Spate

, Wax

, Murphy

, Rieke

, Whitworth

, Linville

, Korte

, Engelhardt

, Welsh

, Prather

(2008) Production of CFTR-null and CFTR-DeltaF508 heterozygous pigs by adeno-associated virus-mediated gene targeting and somatic cell nuclear transfer. J Clin Invest 118, 1571–1577.

Rogers

, Stoltz

, Meyerholz

, Ostedgaard

, Rokhlina

, Taft

, Rogan

, Pezzulo

, Karp

, Itani

, Kabel

, Wohlford-Lenane

, Davis

, Hanfland

, Smith

, Samuel

, Wax

, Murphy

, Rieke

, Whitworth

, Uc

, Starner

, Brogden

, Shilyansky

, McCray

Jr , Zabner

, Prather

, Welsh

(2008) Disruption of the CFTR gene produces a model of cystic fibrosis in newborn pigs. Science 321, 1837–1841.

Stoltz

, Meyerholz

, Pezzulo

, Ramachandran

, Rogan

, Davis

, Hanfland

, Wohlford-Lenane

, Dohrn

, Bartlett

, Nelson

GAt

, Chang

, Taft

, Ludwig

, Estin

, Hornick

, Launspach

, Samuel

, Rokhlina

, Karp

, Ostedgaard

, Uc

, Starner

, Horswill

, Brogden

, Prather

, Richter

, Shilyansky

, McCray

Jr , Zabner

, Welsh

(2010) Cystic fibrosis pigs develop lung disease and exhibit defective bacterial eradication at birth. Sci Transl Med 2, 29ra31.

Ostedgaard

, Meyerholz

, Chen

, Pezzulo

, Karp

, Rokhlina

, Ernst

, Hanfland

, Reznikov

, Ludwig

, Rogan

, Davis

, Dohrn

, Wohlford-Lenane

, Taft

, Rector

, Hornick

, Nassar

, Samuel

, Zhang

, Richter

, Uc

, Shilyansky

, Prather

, McCray

Jr , Zabner

, Welsh

, Stoltz

(2011) The DeltaF508 mutation causes CFTR misprocessing and cystic fibrosis-like disease in pigs. Sci Transl Med 3, 74ra24.

Al-Mashhadi

, Sorensen

, Kragh

, Christoffersen

, Mortensen

, Tolbod

, Thim

, Du

, Li

, Liu

, Moldt

, Schmidt

, Vajta

, Larsen

, Purup

, Bolund

, Nielsen

, Callesen

, Falk

, Mikkelsen

, Bentzon

(2013) Familial hypercholesterolemia and atherosclerosis in cloned minipigs created by DNA transposition of a human PCSK9 gain-of-function mutant. Sci Transl Med 5, 166ra1.

Davis

, Wang

, Rohret

, Struzynski

, Merricks

, Bellinger

, Rohret

, Nichols

, Rogers

(2014) Targeted disruption of LDLR causes hypercholesterolemia and atherosclerosis in Yucatan miniature pigs. PLoS One 9, e93457.

Tanzi

(2012) The genetics of Alzheimer disease. Cold Spring Harb Perspect Med 2, pii:a006296.

Lambert

, Ibrahim-Verbaas

, Harold

, Naj

, Sims

, Bellenguez

, DeStafano

, Bis

, Beecham

, Grenier-Boley

, Russo

, Thorton-Wells

, Jones

, Smith

, Chouraki

, Thomas

, Ikram

, Zelenika

, Vardarajan

, Kamatani

, Lin

, Gerrish

, Schmidt

, Kunkle

, Dunstan

, Ruiz

, Bihoreau

, Choi

, Reitz

, Pasquier

, Cruchaga

, Craig

, Amin

, Berr

, Lopez

, De Jager

, Deramecourt

, Johnston

, Evans

, Lovestone

, Letenneur

, Moron

, Rubinsztein

, Eiriksdottir

, Sleegers

, Goate

, Fievet

, Huentelman

, Gill

, Brown

, Kamboh

, Keller

, Barberger-Gateau

, McGuiness

, Larson

, Green

, Myers

, Dufouil

, Todd

, Wallon

, Love

, Rogaeva

, Gallacher

, St George-Hyslop

, Clarimon

, Lleo

, Bayer

, Tsuang

, Yu

, Tsolaki

, Bossu

, Spalletta

, Proitsi

, Collinge

, Sorbi

, Sanchez-Garcia

, Fox

, Hardy

, Deniz Naranjo

, Bosco

, Clarke

, Brayne

, Galimberti

, Mancuso

, Matthews

, Moebus

, Mecocci

, Del Zompo

, Maier

, Hampel

, Pilotto

, Bullido

, Panza

, Caffarra

, Nacmias

, Gilbert

, Mayhaus

, Lannefelt

, Hakonarson

, Pichler

, Carrasquillo

, Ingelsson

, Beekly

, Alvarez

, Zou

, Valladares

, Younkin

, Coto

, Hamilton-Nelson

, Gu

, Razquin

, Pastor

, Mateo

, Owen

, Faber

, Jonsson

, Combarros

, O’Donovan

, Cantwell

, Soininen

, Blacker

, Mead

, Mosley

Jr , Bennett

, Harris

, Fratiglioni

, Holmes

, de Bruijn

, Passmore

, Montine

, Bettens

, Rotter

, Brice

, Morgan

, Foroud

, Kukull

, Hannequin

, Powell

, Nalls

, Ritchie

, Lunetta

, Kauwe

, Boerwinkle

, Riemenschneider

, Boada

, Hiltuenen

, Martin

, Schmidt

, Rujescu

, Wang

, Dartigues

, Mayeux

, Tzourio

, Hofman

, Nothen

, Graff

, Psaty

, Jones

, Haines

, Holmans

, Lathrop

, Pericak-Vance

, Launer

, Farrer

, van Duijn

, Van Broeckhoven

, Moskvina

, Seshadri

, Williams

, Schellenberg

, Amouyel

(2013) Meta-analysis of 74,046 individuals identifies 11 new susceptibility loci for Alzheimer’s disease. Nat Genet 45, 1452–1458.

10.

Selkoe

(2012) Preventing Alzheimer’s disease. Science 337, 1488–1492.

11.

Wirths

, Bayer

(2012) Intraneuronal Aβ accumulation and neurodegeneration: Lessons from transgenic models. Life Sci 91, 1148–1152.

12.

McGowan

, Eriksen

, Hutton

(2006) A decade of modeling Alzheimer’s disease in transgenic mice. Trends Genet 22, 281–289.

13.

Cohen

, Rezai-Zadeh

, Weitz

, Rentsendorj

, Gate

, Spivak

, Bholat

, Vasilevko

, Glabe

, Breunig

, Rakic

, Davtyan

, Agadjanyan

, Kepe

, Barrio

, Bannykh

, Szekely

, Pechnick

, Town

(2013) A transgenic Alzheimer rat with plaques, tau pathology, behavioral impairment, oligomeric abeta, and frank neuronal loss. J Neurosci 33, 6245–6256.

14.

Do Carmo

, Cuello

(2013) Modeling Alzheimer’s disease in transgenic rats. Mol Neurodegener 8, 37.

15.

Holm

, Alstrup

, Luo

(2016) Genetically modified pig models for neurodegenerative disorders. J Pathol 238, 267–287.

16.

Holcomb

, Gordon

, McGowan

, Yu

, Benkovic

, Jantzen

, Wright

, Saad

, Mueller

, Morgan

, Sanders

, Zehr

, O’Campo

, Hardy

, Prada

, Eckman

, Younkin

, Hsiao

, Duff

(1998) Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes. Nat Med 4, 97–100.

17.

Mullan

, Crawford

, Axelman

, Houlden

, Lilius

, Winblad

, Lannfelt

(1992) A pathogenic mutation for probable Alzheimer’s disease in the APP gene at the N-terminus of beta-amyloid. Nat Genet 1, 345–347.

18.

Borchelt

, Ratovitski

, van Lare

, Lee

, Gonzales

, Jenkins

, Copeland

, Price

, Sisodia

(1997) Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 19, 939–945.

19.

Jakobsen

, Johansen

, Schmidt

, Dagnaes-Hansen

, Dam

, Gunnarsson

, Liu

, Kragh

, Li

, Holm

, Callesen

, Mikkelsen

, Nielsen

, Jorgensen

(2013) Generation of minipigs with targeted transgene insertion by recombinase-mediated cassette exchange (RMCE) and somatic cell nuclear transfer (SCNT). Transgenic Res 22, 709–723.

20.

Jakobsen

, Li

, Kragh

, Moldt

, Lin

, Liu

, Schmidt

, Winther

, Schyth

, Holm

, Vajta

, Bolund

, Callesen

, Jorgensen

, Nielsen

, Mikkelsen

(2011) Pig transgenesis by Sleeping Beauty DNA transposition. Transgenic Res 20, 533–545.

21.

Kragh

, Nielsen

, Li

, Du

, Lin

, Schmidt

, Bogh

, Holm

, Jakobsen

, Johansen

, Purup

, Bolund

, Vajta

, Jorgensen

(2009) Hemizygous minipigs produced by random gene insertion and handmade cloning express the Alzheimer’s disease-causing dominant mutation AβPPsw. Transgenic Res 18, 545–558.

22.

Jakobsen

, Mikkelsen

, Nielsen

(2010) Elimination of the plasmid bacterial backbone in site-directed transgenesis. Biotechniques 48, 313–316.

23.

Schmidt

, Kragh

, Li

, Du

, Lin

, Bøgh

, Winther

, Vajta

, Callesen

(2010) Pregnancies and piglets from large white sow recipients after two transfer methods of cloned and transgenic embryos of different pig breeds. Theriogenology 74, 1233–1240.

24.

Mathews

, Cataldo

, Kao

, Rudnicki

, Qin

, Yang

, Jiang

, Picciano

, Hulette

, Lippa

, Bird

, Nochlin

, Walter

, Haass

, Lévesque

, Fraser

, Andreadis

, Nixon

(2000) Brain expression of presenilins in sporadic and early-onset, familial Alzheimer’s disease. Mol Med 6, 878–891.

25.

Mathews

, Jiang

, Schmidt

, Grbovic

, Mercken

, Nixon

(2002) Calpain activity regulates the cell surface distribution of amyloid precursor protein. J Biol Chem 277, 36415–36424.

26.

Wirths

, Bethge

, Marcello

, Harmeier

, Jawhar

, Lucassen

, Multhaup

, Brody

, Esparza

, Ingelsson

, Kalimo

, Lannfelt

, Bayer

(2010) Pyroglutamate Abeta pathology in AβPP/PS1KI mice, sporadic and familial Alzheimer’s disease cases. J Neural Transm 117, 85–96.

27.

Bouter

, Dietrich

, Wittnam

, Rezaei-Ghaleh

, Pillot

, Papot-Couturier

, Lefebvre

, Sprenger

, Wirths

, Zweckstetter

, Bayer

(2013) N-truncated amyloid β (Aβ) 4-42 forms stable aggregates and induces acute and long-lasting behavioral deficits. Acta Neuropathol 126, 189–205.

28.

De Strooper

, Iwatsubo

, Wolfe

(2012) Presenilins and gamma-secretase: Structure, function, and role in Alzheimer Disease. Cold Spring Harb Perspect Med 2, a006304.

29.

Bates

, Verdile

, Li

, Ames

, Hudson

, Masters

, Martins

(2009) Clearance mechanisms of Alzheimer’s amyloid-beta peptide: Implications for therapeutic design and diagnostic tests. Mol Psychiatry 14, 469–486.

30.

Wirths

, Multhaup

, Bayer

(2004) A modified beta-amyloid hypothesis: Intraneuronal accumulation of the beta-amyloid peptide–the first step of a fatal cascade. J Neurochem 91, 513–520.

31.

Bayer

, Wirths

(2010) Intracellular accumulation of amyloid-Beta - a predictor for synaptic dysfunction and neuron loss in Alzheimer’s disease. Front Aging Neurosci 2, 8.

32.

Gouras

, Tampellini

, Takahashi

, Capetillo-Zarate

(2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer’s disease. Acta Neuropathol 119, 523–541.

33.

Gouras

, Tsai

, Naslund

, Vincent

, Edgar

, Checler

, Greenfield

, Haroutunian

, Buxbaum

, Xu

, Greengard

, Relkin

(2000) Intraneuronal Abeta42 accumulation in human brain. Am J Pathol 156, 15–20.

34.

Gyure

, Durham

, Stewart

, Smialek

, Troncoso

(2001) Intraneuronal abeta-amyloid precedes development of amyloid plaques in Down syndrome. Arch Pathol Lab Med 125, 489–492.

35.

Takahashi

, Milner

, Li

, Nam

, Edgar

, Yamaguchi

, Beal

, Xu

, Greengard

, Gouras

(2002) Intraneuronal Alzheimer abeta42 accumulates in multivesicular bodies and is associated with synaptic pathology. Am J Pathol 161, 1869–1879.

36.

Knobloch

, Konietzko

, Krebs

, Nitsch

(2007) Intracellular Abeta and cognitive deficits precede beta-amyloid deposition in transgenic arcAbeta mice. Neurobiol Aging 28, 1297–1306.

37.

Lord

, Kalimo

, Eckman

, Zhang

, Lannfelt

, Nilsson

(2006) The Arctic Alzheimer mutation facilitates early intraneuronal Abeta aggregation and senile plaque formation in transgenic mice. Neurobiol Aging 27, 67–77.

38.

Schmitz

, Rutten

, Pielen

, Schafer

, Wirths

, Tremp

, Czech

, Blanchard

, Multhaup

, Rezaie

, Korr

, Steinbusch

, Pradier

, Bayer

(2004) Hippocampal neuron loss exceeds amyloid plaque load in a transgenic mouse model of Alzheimer’s disease. Am J Pathol 164, 1495–1502.

39.

Wirths

, Multhaup

, Czech

, Blanchard

, Moussaoui

, Tremp

, Pradier

, Beyreuther

, Bayer

(2001) Intraneuronal Abeta accumulation precedes plaque formation in beta-amyloid precursor protein and presenilin-1 double-transgenic mice. Neurosci Lett 306, 116–120.

40.

Oakley

, Cole

, Logan

, Maus

, Shao

, Craft

, Guillozet-Bongaarts

, Ohno

, Disterhoft

, Van Eldik

, Berry

, Vassar

(2006) Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer’s disease mutations: Potential factors in amyloid plaque formation. J Neurosci 26, 10129–10140.

41.

Casas

, Sergeant

, Itier

, Blanchard

, Wirths

, van der Kolk

, Vingtdeux

, van de Steeg

, Ret

, Canton

, Drobecq

, Clark

, Bonici

, Delacourte

, Benavides

, Schmitz

, Tremp

, Bayer

, Benoit

, Pradier

(2004) Massive CA1/2 neuronal loss with intraneuronal and N-terminal truncated Abeta42 accumulation in a novel Alzheimer transgenic model. Am J Pathol 165, 1289–1300.

42.

Christensen

, Bayer

, Wirths

(2010) Intracellular Aβ triggers neuron loss in the cholinergic system of the APP/PS1KI mouse model of Alzheimer’s disease. Neurobiol Aging 31, 1153–1163.

43.

Christensen

, Kraus

, Flohr

, Cotel

, Wirths

, Bayer

(2008) Transient intraneuronal Aβ rather than extracellular plaque pathology correlates with neuron loss in the frontal cortex of APP/PS1KI mice. Acta Neuropathol 116, 647–655.

44.

Oddo

, Caccamo

, Shepherd

, Murphy

, Golde

, Kayed

, Metherate

, Mattson

, Akbari

, LaFerla

(2003) Triple-transgenic model of Alzheimer’s disease with plaques and tangles: Intracellular Abeta and synaptic dysfunction. Neuron 39, 409–421.

45.

Eimer

, Vassar

(2013) Neuron loss in the 5XFAD mouse model of Alzheimer’s disease correlates with intraneuronal Aβ42 accumulation and Caspase-3 activation. Mol Neurodegener 8, 2.

46.

Mori

, Spooner

, Wisniewsk

, Wisniewski

, Yamaguch

, Saido

, Tolan

, Selkoe

, Lemere

(2002) Intraneuronal Abeta42 accumulation in Down syndrome brain. Amyloid 9, 88–102.

47.

Wegiel

, Kuchna

, Nowicki

, Frackowiak

, Mazur-Kolecka

, Imaki

, Wegiel

, Mehta

, Silverman

, Reisberg

, Deleon

, Wisniewski

, Pirttilla

, Frey

, Lehtimaki

, Kivimaki

, Visser

, Kamphorst

, Potempska

, Bolton

, Currie

, Miller

(2007) Intraneuronal Abeta immunoreactivity is not a predictor of brain amyloidosis-beta or neurofibrillary degeneration. Acta Neuropathol 113, 389–402.

48.

Citron

, Oltersdorf

, Haass

, McConlogue

, Hung

, Seubert

, Vigo-Pelfrey

, Lieberburg

, Selkoe

(1992) Mutation of the beta-amyloid precursor protein in familial Alzheimer’s disease increases beta-protein production. Nature 360, 672–674.

49.

Borchelt

, Thinakaran

, Eckman

, Lee

, Davenport

, Ratovitsky

, Prada

, Kim

, Seekins

, Yager

, Slunt

, Wang

, Seeger

, Levey

, Gandy

, Copeland

, Jenkins

, Price

, Younkin

, Sisodia

(1996) Familial Alzheimer’s disease-linked presenilin 1 variants elevate Abeta1-42/1-40 ratio in vitro and in vivo. Neuron 17, 1005–1013.

50.

Citron

, Westaway

, Xia

, Carlson

, Diehl

, Levesque

, Johnson-Wood

, Lee

, Seubert

, Davis

, Kholodenko

, Motter

, Sherrington

, Perry

, Yao

, Strome

, Lieberburg

, Rommens

, Kim

, Schenk

, Fraser

, St George Hyslop

, Selkoe

(1997) Mutant presenilins of Alzheimer’s disease increase production of 42-residue amyloid beta-protein in both transfected cells and transgenic mice. Nat Med 3, 67–72.

51.

Saito

, Matsuba

, Mihira

, Takano

, Nilsson

, Itohara

, Iwata

, Saido

(2014) Single AβPP knock-in mouse models of Alzheimer’s disease. Nat Neurosci 17, 661–663.