Association of Folate Metabolites and Mitochondrial Function in Peripheral Blood Cells in Alzheimer’s Disease: A Matched Case-Control Study

Abstract

Background:

The nutrition state plays an important role in the progress of aging. Folate may play a role in protecting mitochondrial (mt) DNA by reducing oxidative stress.

Objective:

The primary aim of this study was to examine the association of mitochondrial oxidative damage with risk of Alzheimer’s disease (AD), and to explore the possible role of folate metabolites in this association in a matched case-control study.

Methods:

Serum folate metabolites and mitochondrial function in peripheral blood cells were determined in 82 AD cases and 82 healthy controls, individually matched by age, gender, and education.

Results:

AD patients had lower serum levels of folate and higher homocysteine (Hcy) concentration. AD patients had a reduced mtDNA copy number, higher mtDNA deletions, and increased 8-OHdG content in mtDNA indicative of reduced mitochondrial function. The highest level of mtDNA copy number would decrease the risk of AD (OR = 0.157, 95% CI: 0.058–0.422) compared to the lowest level, independently of serum folate, and Hcy levels. Serum folate levels correlated with low 8-OHdG content in mtDNA both in AD patients and controls, independently of serum Hcy level. Moreover, serum Hcy levels correlated with low copy number in mtDNA both in AD patients and controls, independently of serum folate levels.

Conclusion:

In conclusion, mitochondrial function in peripheral blood cells could be associated with risk of AD independent of multiple covariates. AD patients with a folate deficiency or hyperhomocysteinemia had low mitochondrial function in peripheral blood cells. However, further randomized controlled trials are need to determine a causal effect.

Keywords

Alzheimer’s disease China folate metabolites mitochondrial function peripheral blood cells

INTRODUCTION

Alzheimer’s disease (AD) is the most common form of dementia among the elderly, characterized by progressive memory loss and cognitive decline. AD affects millions of people worldwide and the number of AD cases will increase with longer life expectancy. Aging is associated with an increase in oxidative stress as well as various health outcomes [1]. Nutrition state plays an important role in the progress of aging. Folate, a B vitamin, is integral to the normal functioning of the central nervous system [2]. Folate deficiency is associated with cognitive decline, dementia, and increased risks of AD through as yet unknown mechanisms [3]. Folate deprivation results in DNA injuries such as increased uracil misincorporation, genomic DNA strand breaks, and global DNA hypomethylation; additionally, folate status could also modulate mitochondrial (mt) DNA stability [4, 5].

A large body of evidence demonstrates that dysfunction in replication and transcription of mtDNA is a feature of many aging-related disorders, from cardiovascular to neurodegenerative diseases. mtDNA copy number may reflect the abundance of mitochondria in a human cell [6]. Mitochondria have many biological roles, such as apoptosis and calcium regulation, and are the major intracellular source and primary target of reactive oxygen species (ROS) that are toxic to them [7, 8]. The deleterious effects on mitochondria are due to its intronless genes without binding to histones and inefficient mtDNA proof-reading and DNA repair system. These changes render mtDNA more susceptible to oxidative damage than nuclear DNA (nDNA) [9]. Accumulation of mtDNA mutations leads to alterations of mitochondrial biogenesis and function that might result in a decrease of mtDNA content within cells. However, the possible role of folate metabolites in mtDNA function and cognitive decline is still not clear.

The primary aim of this study was to examine the association of mtDNA function and cognitive decline, and further to explore the possible role of folate metabolites in this association.

MATERIALS AND METHODS

Study subjects

The study recruited AD patients from the neurology departments of Tianjin Huanhu Hospital in Tianjin, North China, between January 2017 to December 2017. All participants were diagnosed with AD based on the National Institute of Neurological and Communicative Disorders and Stroke and Alzheimer Disease and Related Disorders Association (NINCDS-ADRDA) criteria by neurologists. Exclusion criteria for AD patients were: 1) the presence of non-Alzheimer’s disease related dementia, 2) significant medical problems (i.e., hepatic or renal failure, chronic respiratory insufficiency) potentially responsible for encephalopathy, 3) bipolar disorder, schizophrenia, and history of drug or alcohol abuse, 4) a concomitant or previous neurological disorder, and 5) age <55 years old [10].

Control subjects were recruited from Baodi Clinical College of Tianjin Medical University and had no active medical therapy and no personal or family history of neurological and psychiatric disorders, as determined by clinical interviews. According to diagnostic criteria, 82 AD patients were recruited in this study, by 1:1 matching gender, age (±2 years), and education year (±2 years) with the control group.

The research protocol was approved by the medical ethics committee of Tianjin Medical University, China. The study was conducted in compliance with the ethical principles of the Declaration of Helsinki. All participants gave informed consent toward participation in the study and its objectives.

Data and biological sample collection

The eligible controls, AD patients and their caregivers were interviewed by the trained interviewers using a self-designed questionnaire. Following overnight fasting (12–14 h), blood samples were collected from each participant. The samples were drawn by venipuncture into 5 ml plain evacuated tubes and then centrifuged at 2000× g for 10 min, then stored at –80°C until use.

Serum folate and homocysteine levels detection

The serum folate concentration was determined using a chemiluminescence enzyme immunoassay by an automated chemiluminescence system (Siemens Immulite 2000 Xpi, Germany) according to the manufacturer’s instructions as previously reported [11]. The serum homocysteine (Hcy) concentration was quantified using an enzymatic cycling method. In brief, serum samples were mixed with Hcy Reagent (Meikang Medical System, China) with absorbance measured at 340 nm by Auto-Chemistry Analyzer (DIRUI Industrial Ltd, China) [11].

mtDNA copy number (Mt/S) measurement

Genomic DNA was isolated from 400μl of each blood sample using the Plus Blood Genomic DNA Purification Kit (GeneMark, China). DNA samples were quantified using the Nanodrop 2000 spectrophotometer (Thermo Scientific, USA). Based on UV absorbance, all extracted DNA samples were diluted and stored at –80°C until use. By using real-time PCR with the GoTaq qPCR Master Mix (Promega, USA), the relative mtDNA copy number was assessed, as previously described [12]. The 20μL PCR mixture included: PCR Master (10μL), DNA (20 ng), forward and reverse primer (200 nM for ND1 gene, 167 nM for β-globin), and water (PCR-grade). Reaction mixtures were incubated for 10 min at 95°C, followed by 30 amplification cycles (95°C for 15 s following by 60°C for 1 min) for ND1 gene; 35 amplification cycles (95°C for 15 s following by 56°C for 1 min) for β-globin. Primers were specific for mt ND1 gene (forward, CCCTAAAACCCGCCACATCT; reverse, GAGCGATGGTGAGAGCTAAGGT). The expression was normalized to the nuclear gene β-globin (forward, GTGCACCTGACTCCTGAGGAGA; reverse, CCTTGATACCAACCTGCCCAG) in order to calculate relative levels. All qPCR assays were performed on a Roche LightCycler 480 machine (Roche Applied Science, Switzerland). The targeted gene (ND1) and single copy gene (β-globin) PCR reactions were carried out on separate runs with the same samples in the same well positions, and melting curve analysis was performed for every run to verify specificity. The measure of mtDNA copy number was determined by the ratio of mtDNA content to a reference single copy gene copy number (Mt/S ratio) in each sample relative to a reference sample.

mtDNA deletions (ND1/ND4) measurement

The multiplex real-time ND1/ND4 assay was used to quantify levels of mtDNA deletions, primers for the mt gene ND4, located in the major arch of the mtDNA where deletion frequently occurs, were used in combination with those of the mt gene ND1, which is rarely deleted. The mtDNA deletion level is reported as the ratio between ND4 and ND1 and thus represented by the quantification of the non-deleted fraction of mtDNA (ND4) versus the total amount of mtDNA (ND1) [13]. The 20μL reaction mixture included: GoldStar TaqMan Mixture (CoWin Biosciences, China) (10μL), DNA (10 ng), primers (300 nM), probes (100 nM), and water (PCR-grade). Primers and sequence specific probes were: for ND1 (forward primer nt 3485–3504, reverse primer nt 3553-3532, FAM-dye-labelled probe nt 3506–3529) and for ND4 (forward primer nt 12087–12109, reverse primer nt 12170-12140, VIC-labelled probe nt 12111–12138). Cycler conditions on a Roche LightCycler 480 machine (Roche Applied Science, Switzerland) were 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C followed by 1 min at 60°C. The Ct values can be used as a measure of input DNA and can be used to quantify the relative amount of ND1 to ND4 with the following equation: R = 2^–ΔCt, where R is the calculated relative copy number and ΔCt is the Ct_ND1 - Ct_ND4.

Measurement of degree of oxidative mtDNA damage (ΔCt)

The content of 8-hydroxy-2’-deoxyguanosine (8-OHdG) in mtDNA was determined by a qPCR. The 8-OHdG residue would be removed by formamidopyrimidine DNA-glycosylase (FPG) to form an abasic site upon sample treatment with FPG [14]. The decreased amplification efficiency would be detected by a qPCR and presented as ΔCt. The DNA sample (20 ng) was treated with or without 1 U/μL of FPG at 37°C for 16 h followed by 10 min at 65°C. The digested DNA was amplified by qPCR on a Roche LightCycler 480 machine (Roche Applied Science, Switzerland) using 500 nM mtF3212 (5’-CACCCAAGAACAGGGTTTGT-3’) and 500 nM mtR3319 (5’-TGGCCATGGGTATGTTGTTA-3’) primers. The PCR conditions were set up as follows: 95°C for 10 min then followed by 40 cycles of 95°C for 20 s, 62°C for 20 s, and 72°C for 20 s. This method is based on differences in PCR kinetics between the DNA template exhaustively digested by FPG and undigested DNA, i.e., change cycle threshold (ΔCt = Ct_treated-Ct_untreated). The larger the ΔCt value means the sample has more 8-OHdG and therefore, more oxidative mtDNA damage.

Statistical analysis

Data was described as mean±SD or percentages depending on the data distribution. Intergroup comparison for metric variables was done by paired-sample Student’s t-test, whereas chi-square test and odds ratio were used for nonmetric variables. Dependence between the one-carbon metabolic markers and the mitochondrial functional markers was evaluated using Pearson’s correlation coefficient. Logistic regression models were used to examine the associations between the mitochondrial functional markers and risk for AD. The strength of a given parameter associated with AD was measured by its OR and the corresponding 95% CI and two-sided p value. Non-normally distributed dependent variables were transformed using a logarithmic function. Differences were considered to be statistically significant at p < 0.05. All analyses were performed using SPSS PASW Statistics for Windows, version 24.0 (SPSS Inc., Chicago, IL, USA).

RESULTS

Baseline data, one-carbon metabolites, and mitochondrial functional markers in the study subjects

The baseline data, clinical markers, one-carbon metabolites, and mitochondrial functional markers of the 164 study subjects were showed on Table 1. In this study, age, sex, and educational levels were matched in the AD case and control groups; there was no difference in age, sex, and educational levels between case and control groups. The controls and AD cases also exhibited a similar distribution in BMI, proportion of B vitamin supplements, smoking habit, alcohol intake, personal history of hypertension, type 2 diabetes, and heart disease. As compared with the controls, AD patients had significantly lower Mini-Mental State Examination scores (p < 0.001). For markers of folate metabolites, lower levels of serum folate (p = 0.054) and elevated Hcy concentrations (p < 0.001) were detected in the AD patients than in the controls.

Table 1

Characteristics of the study population (controls and patients with Alzheimer’s disease) (n = 82)

Variable	Controls	AD patients	t/Z/ x ²	p
Demographics
BMI, kg/m²	24.72±2.48	24.26±2.37	1.166	0.247
B vitamin supplements, n (%)^*	20 (24.39)	16 (19.51)	–0.707	0.480
Smoking status			–0.617	0.537
Current, n (%)	16 (19.52)	20 (24.39)
Former, n (%)	12 (14.63)	9 (10.98)
Never, n (%)	54 (65.85)	53 (64.63)
Alcohol drinking, n (%)	21 (25.61)	20 (24.39)	–0.209	0.835
Clinical characteristics
MMSE scores	28.52±1.18	16.95±4.86	21.239	<0.001
Hypertension, n (%)	35 (42.68)	29 (35.37)	–0.973	0.330
T2DM, n (%)	15 (18.29)	14 (17.07)	–0.200	0.841
Heart disease, n (%)	13 (15.85)	7 (8.54)	–1.342	0.180
Biochemical measures
Serum folate, ng/ml	6.30 (4.89,8.27)	5.50 (4.05,8.03)	1.953	0.054
Serum Hcy, μmol/L	12.64 (11.22,16.03)	17.69 (13.45,21.48)	–5.498	<0.001
Mitochondrial function
mtDNA copy number (Mt/S ratio)	1.59 (1.29,1.89)	1.19 (0.94,1.43)	–4.880	<0.001
mtDNA deletions (ND1/ND4)	1.65 (1.56,1.69)	1.70 (1.66,1.74)	–6.042	<0.001
Degree of oxidative mtDNA damage (ΔCt)	0.71 (0.59,0.94)	1.31 (1.09,1.59)	–7.640	<0.001

Results are shown as n (%) for the chi-squared test, as the mean±the standard deviation for paired-sample t test and as median (P25, P75) for paired-sample Wilcoxon signed-rank test. AD, Alzheimer’s disease; BMI, body mass index; MMSE, Mini-Mental State Examination; T2DM, type 2 diabetes mellitus; Hcy, homocysteine. ^*Intake of multivitamin supplements or any type of B vitamin supplements.

The relationship of mitochondrial function in peripheral blood cells and AD

AD patients had lower levels of mtDNA copy number (p < 0.001); however, AD patients had an increased frequency of mtDNA deletions (p < 0.001) and 8-OHdG content in mtDNA (p < 0.001) in peripheral leukocytes than the controls (Table 1 and Fig. 1). More AD patients belong to the lowest level of mtDNA copy number relative to controls (45% AD patients versus 13.4% controls) (p < 0.001); fewer AD patients belong to the lowest level of mtDNA deletions relative to controls (7.3% AD patients versus 42.7% controls) (p < 0.001); and fewer AD patients had the lowest 8-OHdG content in mtDNA deletions when compared to controls (7.3% AD patients versus 64.6% controls) (p < 0.001) (Table 2).

Fig.1

Scatter dot plot of the mitochondrial functional markers for AD cases and matched controls. A) mtDNA copy number (Mt/S) in AD patients and healthy controls. B) mtDNA deletions (ND1/ND4) in AD patients and healthy controls. C) The degree of oxidative mtDNA damage (ΔCt) in AD patients and healthy controls. Data was expressed as mean±SD. ^*p < 0.05, significantly different from the control group.

Table 2

Mitochondrial oxidative damage in relation to Alzheimer’s disease

Mitochondrial function	Controls, n (%)	AD patients, n (%)	χ ²	p
mtDNA copy number (Mt/S ratio)			30.292	<0.001
<1.16	11 (13.4)	37 (45.1)
1.16–1.34	25 (30.5)	30 (36.6)
>1.34	46 (56.1)	15 (18.3)
mtDNA deletions (ND1/ND4)			28.623	<0.001
<1.62	35 (42.7)	6 (7.3)
1.62–1.66	21 (25.6)	26 (31.7)
>1.66	26 (31.7)	50 (61.0)
8-OHdG content in mtDNA (ΔCt)			84.308	<0.001
<0.78	53 (64.6)	6 (7.3)
0.78–1.13	25 (30.5)	19 (23.2)
>1.13	4 (4.9)	57 (69.5)

Multivariate logistic regression analysis was used to assess the markers of mitochondrial function on the likelihood of having AD. Leukocytotic mtDNA copy number is negatively associated with the risk of AD; highest level of leukocytotic mtDNA copy number would decrease the possibility of AD (OR = 0.097, 95% CI: 0.040–0.236). Additionally, this is also observed when adjusting for serum folate and Hcy (OR = 0.157, 95% CI: 0.058–0.422) (Fig. 2).

Fig.2

Forest plots were used to show OR and 95% CIs of mtDNA copy number in relation to AD. The mark of “♦” indicated OR value. ^aadjusted model by serum folate level; and ^badjusted model by serum folate and Hcy level.

The relationship of mitochondrial function in peripheral blood cells and folate metabolites

A serum folate level less than 6 ng/ml was defined as a folate deficiency. More AD patients were folate deficient relative to controls (56.1% AD patients versus 46.3% controls). Folate deficient AD patients also had lower levels of mtDNA copy number (p = 0.132), higher levels of mtDNA deletions (p = 0.765) and 8-OHdG content in mtDNA (p = 0.001) relative to non-deficient AD patients (Fig. 3). A similar observation was found in the control group (p = 0.034, p = 0.012, and p = 0.002, respectively) (Fig. 3). Serum Hcy levels higher than 15μM were defined as having hyperhomocysteinemia (Hhcy), with more AD patients diagnosed with Hhcy (65.9% AD patients versus 29.3% controls). AD patients with Hhcy had lower levels of mtDNA copy number (p = 0.003), higher levels of mtDNA deletions (p = 0.736) and 8-OHdG content in mtDNA (p < 0.001) (Fig. 3). A similar observation was found in the control group (p = 0.002, p = 0.021, and p = 0.045, respectively) (Fig. 3).

Fig.3

Scatter dot plot of the mitochondrial functional markers in different folate or Hcy level for AD cases and/or matched controls. A) mtDNA copy number (Mt/S) in different folate or Hcy level for AD patients and/or healthy controls. B) mtDNA deletions (ND1/ND4) in different folate or Hcy level for AD patients and/or healthy controls. C) The degree of oxidative mtDNA damage (ΔCt) in different folate or Hcy level for AD patients and/or healthy controls. Hhcy, hyperhomocysteinemia. Data was expressed as mean±SD. ^*p < 0.05 compare with control and AD patients at same serum folate or Hcy level. ^#p < 0.05 compare with different serum folate or Hcy level at same pathology.

A partial correlation analysis, corrected by age and gender, revealed that in all the populations, serum folate level was significantly and positively correlated with mtDNA copy number (r = 0.287, p < 0.001); however, serum folate level was significantly and negatively correlated with mtDNA deletions and 8-OHdG content in mtDNA (r = –0.200, p = 0.011 and r = –0.351, p < 0.001, respectively). A partial correlation analysis, corrected by age and gender, revealed that in all the populations, serum Hcy level was significantly and negatively correlated with mtDNA copy number (r = –0.428, p < 0.001); however, serum Hcy level was significantly and positively correlated with mtDNA deletions and 8-OHdG content in mtDNA (r = 0.545, p < 0.001 and r = 0.312, p < 0.001, respectively).

Linear regression was used to detect the relationship of folate metabolites and mitochondrial function. Serum folate correlated with the high mtDNA copy number both in AD patients and controls, however, these associations were not statistically significant after adjusting for serum Hcy level. The strongest correlations were seen with the 8-OHdG content in mtDNA both in AD patients and controls. These associations were also observed when adjusting for serum Hcy level (Table 3). Serum Hcy level correlated with low mtDNA copy number both in AD patients and controls. These observations were also noted when adjusting for serum folate level. Serum Hcy correlated with high mtDNA deletions in the control group, but not in AD patients. This relationship also existed in control group when adjusting for serum folate. The strongest correlations were seen with the 8-OHdG content in mtDNA both in AD patients and controls. This observation was also noted in AD patients when adjusting for serum folate level (Table 3).

Table 3

The relationship between serum folate or Hcy level and mitochondrial oxidative damage in controls and Alzheimer’s disease groups

		Controls		AD patients
		β coefficient	p	β coefficient	p
Folate
Mt/S ratio	Unadjusted	1.92 (0.45, 3.39)	0.011	1.82 (0.26, 3.39)	0.023
	Adjusted ^a	0.94 (–0.58, 2.46)	0.222	1.09 (–0.45, 2.64)	0.163
ND1/ND4	Unadjusted	–10.99 (–17.80, –4.17)	0.002	–0.27 (–10.59, 10.05)	0.959
	Adjusted ^a	–6.96 (–13.96, 0.04)	0.051	0.52 (–9.04, 10.08)	0.914
ΔCt	Unadjusted	–4.82 (–7.64, –2.00)	0.001	–4.22 (–6.10, –2.35)	<0.001
	Adjusted ^a	–3.74 (–6.46, –1.02)	0.008	–3.19 (–5.27, –1.12)	0.003
Hcy
Mt/S ratio	Unadjusted	–3.60 (–5.44, –1.77)	<0.001	–4.88 (–8.48, –1.27)	0.009
	Adjusted ^b	–2.79 (–4.60, –0.98)	0.003	–3.43 (–6.94, 0.09)	0.056
ND1/ND4	Unadjusted	16.00 (7.22, 24.77)	<0.001	4.68 (–19.30, 28.65)	0.699
	Adjusted ^b	11.41 (2.54, 20.28)	0.012	4.43 (–17.76, 26.63)	0.692
ΔCt	Unadjusted	4.09 (0.25, 7.92)	0.037	10.20 (5.88, 14.52)	<0.001
	Adjusted ^b	1.72 (–2.13, 5.58)	0.376	7.94 (3.21, 12.66)	0.001

^aadjusted by Hcy; ^badjusted by folate.

DISCUSSION

The present study found that AD patients with folate deficiency or Hhcy had low mtDNA function in their peripheral blood cells. The copy number of mtDNA was associated with risk of AD independently of age, gender, educational level, serum folate, and Hcy levels. Serum folate correlated with low 8-OHdG content in mtDNA both in AD patients and controls, independently of serum Hcy level. Moreover, serum Hcy correlated with low copy number and high 8-OHdG content in mtDNA both in AD patients and controls, independently of serum folate level. We believe that our study makes a significant contribution to the literature because we found that patients with AD had significantly lower folate levels relative to control, healthy subjects, leaving huge implications for antioxidant therapy and neurological disease.

This study found that AD patients had lower mtDNA function as a result of a lower copy number, higher deletion, and higher amount of 8-OHdG in mtDNA, relative to control samples, which is has been similarly observed in a previous study [15]. The mtDNA copy number decreases with increasing age, mtDNA copy number variation, which reflects the oxidant-induced cell damage, has been observed in a wide range of human diseases [16]. Among various types of mtDNA mutations, oxidative stress-associated large-scale deletions of mtDNA, a 4977 bp deletion in humans, are commonly found to accumulate in aging tissues [4]. Among the many types of DNA damage caused by ROS, the formation of 8-OHdG is the most common one. Thus, the amount of 8-OHdG in mtDNA, a marker of oxidative damage to guanine (G), may also be an index for cellular oxidative damage [17].

This study found that the mtDNA function was associated with risk of AD independently of age, gender, educational level, and serum folate, Hcy concentration, again, this result was observed in a previous study [15]. Previous study supported that oxidative stress may trigger active and self-perpetuating chronic neuroinflammation that may contribute to irreversible neuronal dysfunction and cell death [18]. Oxidative damage was widely implicated in the pathogenesis of AD, occurring early in the AD brain, before the onset of plaque pathology and after the deposition of brain fibrillar Aβ peptide [19]. In brain tissues of AD patients, oxidative stress-related insult is frequently observed based on increased levels of lipid peroxidation, proteins, and nucleic acids [20]. Nucleic acids, particularly mtDNA, are the primary target of free radical damage due to a low level of DNA repair and the proximity of ROS generated by respiratory chains [21]. Elevated oxidative damage in mtDNA was associated with mitochondrial respiratory chain dysfunction and vicious ROS cycles, which may result in apoptotic cell death [22]. Accumulating evidence suggests that AD may be associated with mtDNA aberrations, elevated oxidative stress, and mitochondrial respiratory dysfunction [23]. Increased mtDNA defects and mitochondrial dysfunction are considered part of the spectrum of chronic oxidative stress during AD development [24].

Numerous investigations have shown that folate deficiency promotes hydrogen peroxide (H₂O₂) generation and lipid peroxidation in human cells and rodent tissues [25]. Folate deprivation results in DNA dysfunction such as: increased uracil misincorporation [26], genomic DNA strand breaks, and global DNA hypomethylation [27]. Several recent studies have demonstrated that folate status could also modulate mtDNA stability [28, 29]. Moreover, a folate deficiency induced elevated Hcy levels, a well-known pro-oxidant that elicits lipid peroxidation and elevates oxidative stress, in neuronal cells [30]. As ROS production can lead to the loss of mtDNA molecules [31], folate deficiency-elicited oxidative stress may be attributable to increased mtDNA deletions. In male Swiss mice, chronic treatment comprising folic acid plus α-tocopherol prevented the increase in the activity of mitochondrial complexes I and IV induced by Aβ_1 - 40 [32]. Folic acid or combination of folic acid and vitamin B₁₂ prevents short-term arsenic trioxide-induced islet cell mitochondrial dysfunction in rat [33]. And other recent study showed that folic acid and vitamin B₁₂ ameliorates nicotine mediated islet cell mitochondrial redox status, apoptotic machinery in rat [34]. Therefore, high levels of folic acid supplementation may counteract mtDNA oxidative injuries and mitochondrial dysfunction [35]. However, there is rare intervention report indicate the correlation of mtDNA dysfunction and folate insufficiency in AD patients. This study demonstrated that serum folate level correlated with low 8-OHdG content in mtDNA both in AD patients and controls. Moreover, serum Hcy level correlated with low copy number in mtDNA both in AD patients and controls, highlighting the importance of nutrition in mtDNA maintenance. Further study, a larger-scale, randomized, controlled trials is needed to indicate the causality correlation.

Glutathione (GSH) plays a key role as an essential cellular antioxidant in the defense of brain cells against oxidative damage induced by ROS. GSH reacts with H₂O₂ catalyzed by glutathione peroxidase (GPx) and converts it to H₂O, and then GSH is oxidized to glutathione disulphide (GSSG). In AD and mild cognitive impairment patients, the GSH levels and GSH/GSSG ratio were decreased in blood compared to age-matched control subjects [36, 37]. Moreover, recent studies showed AD-dependent reduction of GSH was observed in both hippocampi and frontal cortices detected by in vivo proton magnetic resonance spectroscopy (MRS) [38]. So, the master antioxidant level GSH in the blood is significantly depleted in AD patients, and that is the same result was found using non-invasive MRS. Folate was a major effector in modulating mitochondrial redox homeostasis via regulating cytosolic GSH biosynthesis, influencing GSH transport system and modulating intracellular redox couples including GSH/GSSG [39].

The present study had a number of limitations, the most important of which being the relatively small sample size, which reduces the statistical power for subgroup analysis. Since blood samples of AD patients were collected after diagnosis, nutritional and mitochondrial genomic parameters might have been changed by the disease condition and/or undeclared medicine use such as the use of medicinal Chinese herbs before the study period. As we know, causality correlation cannot be determined from case-control study. The inherent limitations associated with this retrospective study do not depict the causal effect of promoting cognitive decline by mtDNA dysfunction and folate insufficiency.

Another major limitation of this study is that the brain tissue and peripheral system are completely different. Quantitatively, the total mtDNA copy numbers in human cells may vary widely because of different energy demands, cell types, or environmental stimulations [16]. Some tissues, especially the brain, are more vulnerable to oxidative stress because of their elevated consumption of oxygen and the consequent generation of large amounts of ROS. Moreover, compared to other tissues, the brain, on one hand, has a lower activity of antioxidant enzymes such as GPx and catalase; on the other hand, it contains elevated concentrations of polyunsaturated fatty acids that are highly susceptible to lipid peroxidation [40]. Impaired insulin production and glucose metabolism in AD brain may cause mitochondrial dysfunction and oxidative stress, which enhances the neurodegenerative process [41]. As we know, low mtDNA concentration in cerebrospinal fluid can be used as a biomarker of early stage AD [42]. However, the standard peripheral blood mtDNA copy number is unknown here, and therefore it is also unknown whether peripheral blood mtDNA can represent whole body mtDNA activity.

In conclusion, mtDNA function in peripheral blood cells is associated with risk of AD, independent of multiple covariates. AD patients with folate deficiency or Hhcy had low mtDNA function in peripheral blood cells. A significant correlation between folate metabolites and mtDNA function was reported in this study; however, there is a need for further randomized controlled trials to determine a causal effect.

Footnotes

ACKNOWLEDGMENTS

This research was supported by a grant from the National Natural Science Foundation of China (No. 81730091).

Authors’ disclosures available online ().

References

Mengel-From

, Thinggaard

, Dalgård

, Kyvik

, Christensen

, Christiansen

(2014) Mitochondrial DNA copy number in peripheral blood cells declines with age and is associated with general health among elderly. Hum Genet 133, 1149–1159.

McGarel

, Pentieva

, Strain

, McNulty

(2015) Emerging roles for folate and related B-vitamins in brain health across the lifecycle. Proc Nutr Soc 74, 46–55.

, Wu

, Zhao

, Ji

, Song

, Zhang

, Huang

(2017) Plasma homocysteine and serum folate and vitamin B12 levels in mild cognitive impairment and Alzheimer’s disease: A case-control study. Nutrients E9, 725.

M-Y

, Kuo

C-S

, Lin

C-Y

, Lu

C-L

, Syu Huang

R-F

(2009) Lymphocytic mitochondrial DNA deletions, biochemical folate status and hepatocellular carcinoma susceptibility in a case-control study. Br J Nutr 102, 715–721.

Chen

T-F

, Chiu

M-J

, Huang

C-T

, Tang

M-C

, Wang

S-J

, Wang

C-C

, Huang

R-FS

(2011) Changes in dietary folate intake differentially affect oxidised lipid and mitochondrial DNA damage in various brain regions of rats in the absence/presence of intracerebroventricularly injected amyloid β-peptide challenge. Br J Nutr 105, 1294–1302.

Lei

, Guo

, Shi

, Zhang

, Kang

, Sun

, Huang

, Wang

(2017) Mitochondrial DNA copy number in peripheral blood cell and hypertension risk among mining workers: A case–control study in Chinese coal miners. J Hum Hypertens 31, 585–590.

Kowaltowski

, Souza-Pinto

NC de

, Castilho

, Vercesi

(2009) Mitochondria and reactive oxygen species. Free Radic Biol Med 47, 333–343.

Wallace

(2010) Mitochondrial DNA mutations in disease and aging. Environ Mol Mutagen 51, 440–450.

Craven

, Alston

, Taylor

, Turnbull

(2017) Recent advances in mitochondrial disease. Annu Rev Genomics Hum Genet 18, 257–275.

10.

Rozzini

, Lanfranchi

, Pilotto

, Catalani

, Gilberti

, Paganelli

, Apostoli

, Padovani

(2018) Serum non-ceruloplasmin non-albumin copper elevation in mild cognitive impairment and dementia due to Alzheimer’s disease: A case control study. J Alzheimers Dis 61, 907–912.

11.

, Li

, Wang

, Wilson

, Huang

(2018) Periconceptional folic acid supplementation benefit to development of early sensory-motor function through increase DNA methylation in rat offspring. Nutrients 10, E292.

12.

Liu

C-S

, Tsai

C-S

, Kuo

C-L

, Chen

H-W

, Lii

C-K

, Ma

Y-S

, Wei

Y-H

(2003) Oxidative stress-related alteration of the copy number of mitochondrial DNA in human leukocytes. Free Radic Res 37, 1307–1317.

13.

, Chinnery

, Durham

, Blakely

, Wardell

, Borthwick

, Taylor

, Turnbull

(2002) Detection and quantification of mitochondrial DNA deletions in individual cells by real-time PCR. Nucleic Acids Res 30, e68.

14.

Karakaya

, Jaruga

, Bohr

, Grollman

, Dizdaroglu

(1997) Kinetics of excision of purine lesions from DNA by Escherichia coli Fpg protein. Nucleic Acids Res 25, 474–479.

15.

Delbarba

, Abate

, Prandelli

, Marziano

, Buizza

, Arce Varas

, Novelli

, Cuetos

, Martinez

, Lanni

, Memo

, Uberti

(2016) Mitochondrial alterations in peripheral mononuclear blood cells from Alzheimer’s disease and mild cognitive impairment patients. Oxid Med Cell Longev 2016, 5923938.

16.

Lin

C-S

, Wang

L-S

, Chou

T-Y

, Hsu

W-H

, Lin

H-C

, Lee

S-Y

, Lee

M-H

, Chang

S-C

, Wei

Y-H

(2013) Cigarette smoking and hOGG1 Ser326Cys polymorphism are associated with 8-OHdG accumulation on mitochondrial DNA in thoracic esophageal squamous cell carcinoma. Ann Surg Oncol 20(Suppl 3), S379–S388.

17.

Lin

C-S

, Wang

L-S

, Tsai

C-M

, Wei

Y-H

(2008) Low copy number and low oxidative damage of mitochondrial DNA are associated with tumor progression in lung cancer tissues after neoadjuvant chemotherapy. Interact Cardiovasc Thorac Surg 7, 954–958.

18.

Boccardi

, Arosio

, Cari

, Bastiani

, Scamosci

, Casati

, Ferri

, Bertagnoli

, Ciccone

, Rossi

, Nocentini

, Mecocci

(2019) Beta-carotene, telomerase activity and Alzheimer’s disease in old age subjects. Eur J Nutr. doi: 10.1007/s00394-019-01892-y.

19.

Mecocci

, Boccardi

, Cecchetti

, Bastiani

, Scamosci

, Ruggiero

, Baroni

(2018) A long journey into aging, brain aging, and Alzheimer’s disease following the oxidative stress tracks. J Alzheimers Dis 62, 1319–1335.

20.

Tramutola

, Lanzillotta

, Perluigi

, Butterfield

(2017) Oxidative stress, protein modification and Alzheimer disease. Brain Res Bull 133, 88–96.

21.

Leuner

, Schütt

, Kurz

, Eckert

, Schiller

, Occhipinti

, Mai

, Jendrach

, Eckert

, Kruse

, Palmiter

, Brandt

, Dröse

, Wittig

, Willem

, Haass

, Reichert

, Müller

(2012) Mitochondrion-derived reactive oxygen species lead to enhanced amyloid beta formation. Antioxid Redox Signal 16, 1421–1433.

22.

Chinnery

, Samuels

, Elson

, Turnbull

(2002) Accumulation of mitochondrial DNA mutations in ageing, cancer, and mitochondrial disease: Is there a common mechanism? Lancet 360, 1323–1325.

23.

Simoncini

, Orsucci

, Caldarazzo Ienco

, Siciliano

, Bonuccelli

, Mancuso

(2015) Alzheimer’s pathogenesis and its link to the mitochondrion. Oxid Med Cell Longev 2015, 803942.

24.

Cabezas-Opazo

, Vergara-Pulgar

, Pérez

, Jara

, Osorio-Fuentealba

, Quintanilla

(2015) Mitochondrial dysfunction contributes to the pathogenesis of Alzheimer’s disease. Oxid Med Cell Longev 2015, 509654.

25.

Huang

, Hsu

, Lin

, Yang

(2001) Folate depletion and elevated plasma homocysteine promote oxidative stress in rat livers. J Nutr 131, 33–38.

26.

Hazra

, Selhub

, Chao

, Ueland

, Hunter

, Baron

(2010) Uracil misincorporation into DNA and folic acid supplementation. Am J Clin Nutr 91, 160–165.

27.

McGlynn

, Wasson

, O’Reilly

, McNulty

, Downes

, Chang

, Hoey

, Molloy

, Ward

, Strain

, McKerr

, Weir

, Scott

(2013) Low colonocyte folate is associated with uracil misincorporation and global DNA hypomethylation in human colorectum. J Nutr 143, 27–33.

28.

Crott

, Choi

S-W

, Branda

, Mason

(2005) Accumulation of mitochondrial DNA deletions is age, tissue and folate-dependent in rats. Mutat Res 570, 63–70.

29.

Chou

Y-F

, Yu

C-C

, Huang

R-FS

(2007) Changes in mitochondrial DNA deletion, content, and biogenesis in folate-deficient tissues of young rats depend on mitochondrial folate and oxidative DNA injuries. J Nutr 137, 2036–2042.

30.

, Ashline

, Dhitavat

, Ortiz

, Collins

, Shea

, Rogers

(2003) Folate deprivation induces neurodegeneration: Roles of oxidative stress and increased homocysteine. Neurobiol Dis 14, 32–42.

31.

Nissanka

, Moraes

(2018) Mitochondrial DNA damage and reactive oxygen species in neurodegenerative disease. FEBS Lett 592, 728–742.

32.

Figueiredo

, Bicca

, Latini

, Prediger

RDS

, Medeiros

, Calixto

(2011) Folic acid plus α-tocopherol mitigates amyloid-β-induced neurotoxicity through modulation of mitochondrial complexes activity. J Alzheimers Dis 24, 61–75.

33.

Majumdar

, Mukherjee

, Maiti

, Karmakar

, Das

, Mukherjee

, Nanda

, Mitra

(2009) Folic acid or combination of folic acid and vitamin B(12) prevents short-term arsenic trioxide-induced systemic and mitochondrial dysfunction and DNA damage. Environ Toxicol 24, 377–387.

34.

Bhattacharjee

, Prasad

, Banerjee

, Singh

, Banerjee

, Bose

, Pal

, Maji

, Mukherjee

(2018) Targeting mitochondria with folic acid and vitamin B12 ameliorates nicotine mediated islet cell dysfunction. Environ Toxicol 33, 988–1000.

35.

Chang

C-M

, Yu

C-C

, Lu

H-T

, Chou

Y-F

, Huang

R-FS

(2007) Folate deprivation promotes mitochondrial oxidative decay: DNA large deletions, cytochrome c oxidase dysfunction, membrane depolarization and superoxide overproduction in rat liver. Br J Nutr 97, 855–863.

36.

Bermejo

, Martín-Aragón

, Benedí

, Susín

, Felici

, Gil

, Ribera

, Villar

(2008) Peripheral levels of glutathione and protein oxidation as markers in the development of Alzheimer’s disease from mild cognitive impairment. Free Radic Res 42, 162–170.

37.

Akkaya

, Yavuzer

, Erkol

, Bozluolcay

, Dinçer

(2017) DNA damage, DNA susceptibility to oxidation and glutathione redox status in patients with Alzheimer’s disease treated with and without memantine. J Neurol Sci 378, 158–162.

38.

Mandal

, Saharan

, Tripathi

, Murari

(2015) Brain glutathione levels–a novel biomarker for mild cognitive impairment and Alzheimer’s disease. Biol Psychiatry 78, 702–710.

39.

Lai

K-G

, Chen

C-F

, Ho

C-T

, Liu

J-J

, Liu

T-Z

, Chern

C-L

(2017) Novel roles of folic acid as redox regulator: Modulation of reactive oxygen species sinker protein expression and maintenance of mitochondrial redox homeostasis on hepatocellular carcinoma. Tumour Biol 39, 1010428317702649.

40.

Abolhassani

, Leon

, Sheng

, Oka

, Hamasaki

, Iwaki

, Nakabeppu

(2017) Molecular pathophysiology of impaired glucose metabolism, mitochondrial dysfunction, and oxidative DNA damage in Alzheimer’s disease brain. Mech Ageing Dev 161, 95–104.

41.

Richetin

, Moulis

, Millet

, Arràzola

, Andraini

, Hua

, Davezac

, Roybon

, Belenguer

, Miquel

M-C

, Rampon

(2017) Amplifying mitochondrial function rescues adult neurogenesis in a mouse model of Alzheimer’s disease. Neurobiol Dis 102, 113–124.

42.

Podlesniy

, Llorens

, Golanska

, Sikorska

, Liberski

, Zerr

, Trullas

(2016) Mitochondrial DNA differentiates Alzheimer’s disease from Creutzfeldt-Jakob disease. Alzheimers Dement 12, 546–555.