Isolation and identification of Streptomyces tunisiensis from Garmsar salt cave soil with antibacterial and gene expression activity against Pseudomonas aeruginosa

Abstract

It is known that more than 70% of the current antibiotics have been produced by Streptomyces; therefore, the main goal of the present study was to isolate halophiles Streptomyces to investigate their antimicrobial properties on the expression of the pathogenic genes of clinically resistant Pseudomonas aeruginosa. To this aim, isolation of Streptomyces from soil was performed by serial dilution method, and cultivation on ISP2 and SCA medium. The secondary metabolite was extracted by ethyl acetate method. The presence of exo A, alg D and oprl genes were determined by PCR in 50 clinical isolates of Pseudomonas aeruginosa. The inhibitory effect of active metabolites on gene expression were investigated by employing the real-time PCR technique. The purification of secondary metabolites were performed by employing the HPLC technique. Moreover, the FTIR technique was employed to determine the functional groups to help performing identifications by employing the LC-MS technique. Finally, selected Streptomyces was identified by 16S ribosomal RNA gene. Accordingly, the possible forms of Streptomyces were isolated and identified, in which Streptomyces number 25 had the highest growth inhibition zone against the clinical strains of Pseudomonas aeruginosa. The obtained results of molecular analysis showed 95.4% similarity to Streptomyces tunisiensis. The effect of selected Streptomyces secondary metabolites reduced expressions of both of exo A and algD genes in 1024μg/mL concentration. In this regard, the potent fraction could be known as an isobutyl Nonactin analogue. The concluding remarks of this work showed the antimicrobial activity of halophilus Streptomyces species against the resistant strains of Pseudomonas aeruginosa with the ability of producing antibiotics proposing for running further investigations to determine the active compound structures.

Keywords

pathogenic gens antibacterial activity halophile

1 Introduction

Pseudomonas aeruginosa (P. aeruginosa) is a main factor of appearing nosocomial infections, especially in patients with cystic fibrosis besides the immunocompromised patients [1]. Dealing with such cases, the production of alginate capsule, secretion of enzymes and toxins such as pyocyanin, pyoverdine, alkaline protease, protease IV, elastase, phospholipase C, rhamnolipids, exotoxin A, and exoenzymes S and T have been seems as the main pathogenesis factors of this bacterium [2, 3]. Although exotoxin A is the main toxin produced by P. aeruginosa, but it is also an important mortality factor [4]. This toxin inactivates EF2, halts protein synthesis, and destroys eukaryotic cells causing defects in the immune system of patients [4]. Alginate is the polysaccharide capsule of P. aeruginosa composed of duplicate D-Mannuronic acid and L-glucuronic acid polymers [5]. Alginate-related pathogenesis in mucoid strains of P. aeruginosa involves several routs of medications such as direct inhibition and interference of phagocytosis, protection of bacteria from antibiotics and any protective response of the host [6]. Biofilm formation, prevention of leukocyte chemotaxis, acquisition of toxic free radicals, the ability to produce antibodies through adjuvant function, stimulation of PMNL response, binding to mucins, facilitation of complement activity, increase in toxic oxygen radicals and the formation of bacterial microcolonies in living conditions are other examples of such routs of actions [6]. Due to observed high resistance of P. aeruginosa strains to the available drugs, the treatment of diseases caused by this bacterium has been complicated [7]. Recently, drugs such as colicin and polymyxin has been re-considered as effective antimicrobial agents; however, these antibiotics also fail to prevent the P. aeruginosa infections and resistance to them has been reported several times [8]. Therefore, the discovery of new anti- P. aeruginosa drugs with specific mechanisms of actions is an urgent need to prevent dangerous conditions of P. aeruginosa infections. In this regard, Actinomycetes have been seen valuable biological resources for the production of secondary antibiotic metabolites [9 –11]. Moreover, several efforts have been focused on recognition of the bioavailability of microorganisms in extreme and harsh environments to see the antimicrobial impacts of their metabolites and species [12 –14].

Indeed, investigating the living systems related mechanism and functions have been always an important issue of saving the human life or keeping safe the environment, in which applicability of several resources have been investigated for approaching these critical purposes [15 –17]. Not only the case of drug developments, but also the case of food characterization has been considered important for saving the lives of human and environment [18 –20]. However, it should be mentioned that such topic has been never stopped for obtaining better achievements, but the obtained successes are not still certain [21 –23]. To this point, performing further investigations are required especially for those related systems with critical roles in the biological fields [24 –29]. Meanwhile, saline and brine environments, halophilic microorganisms and their metabolites have been considered accordingly [30]. Many halophilic Streptomyces strains have been isolated from salt extraction plants up to now to specifically produce antimicrobial compounds and salt-resistant enzymes [31 –33]. The topic of exploring biological active compounds for doing specific functions in living systems is indeed a non-stopping research activity [34 –36]. Hereby, the goal of this study was to isolate and identify halophilic Streptomyces from the soil of salt caves in Garmsar city of Iran. This work was aimed to investigate the antimicrobial effects of the secondary metabolites on standard microbes and clinical strains of P. aeruginosa as well as recognizing the impacts on the expression of exotoxin A (exoA) and alginate D (algD) genes. Finally, the active ingredients of secondary metabolites of Streptomyces were tried to be recognized.

2 Materials and methods

2.1 Collection of soil samples

Fifty five soil samples were collected from unspoiled sites of a salt mine and salt caves of Garmsar city (35°14^′46^′′N 52°9^′19^′′E) of Iran and they were transferred to the laboratory within 24 h. The sampling step was done twice in summer time of 2019. The Salinity percentage of all soil samples were measured using a Refractometer (Portable-TRANS model) and their pH were determined using a pH-meter of Metrohm model.

2.2 Isolation and purification of Streptomyces from soil samples

Serial dilution was used for the isolation of Streptomyces and 1 mL of 10^–3 to 10^–7 dilutions was removed and streak cultured on Starch Casein Medium Agar (SCMA; Merck) with 5, 10, 15, and 20 % of salt concentrations. To prevent the growth of fungi, cyclohexidine (50μg/mL) and rifampin (0.5μg/mL) were added to all plates keeping at 28°C for 7–14 days. After incubation, the dry and powdery colonies were transferred to International Streptomyces Project Medium (ISP2) containing 15 % of NaCl salt, purified and stored [37 –39].

2.3 Primary diagnosis of Streptomyces

Macroscopic observation: The shape and color of the colonies were examined and chalk-white and powdery colonies were selected [40].

Microscopic observation: Gram staining was used for microscopic examination and the filamentous and thin structure of these bacteria was visualized under a light microscope [40].

Biochemical properties of Streptomyces strains were determined using the methods of Kämpfer study [41]. The presence of Diaminopymelic acid (DAP) in the cell wall of Streptomyces strains was confirmed by thin-layer chromatography (TLC) [42].

2.4 Collection of clinical samples, phenotypic and biochemical identification of P. aeruginosa

Fifty clinical samples were obtained from the Imam Khomeini Hospital Laboratory in Tehran city of Iran. To confirm the initial identification of Pseudomonas strains, gram staining and biochemical tests for oxidase, reduction of nitrate, arginine dihydrolase and lysine decarboxylase, oxidation of glucose and mannitol as well as growth at 42°C were performed. The antibiogram of Pseudomonas isolates for Ceftazidime, Ticarcillin, Meropenem Cefipime, Amikacin, Imepenam, Gentamicin, Ciprofloxacillin, Cefotaxime was performed by disk diffusion method [43].

2.5 Molecular detection of the presence of exoA and algD pathogenic genes in Pseudomonas isolates

DNA extraction from P. aeruginosa culture was performed according to manufacturer instructions of Takapouzist Company of Iran. The primers of PCR for exoA and algD genes were ordered to Takapouzist Company according to Table 1 [44]. The PCR include pre-denaturation at 95°C for 2 min, denaturation at 95°C for 1 min in 35 cycles, annealing at 56°C for 30 s, extension at 72°C for 1 min, and extension at 72°C for 5 min using the kit of Sinaclon Company of Iran.

Table 1
Primers used in PCR of P. aeroginusa species

Gene Forward Primer Primer length Reverse Primer Primer length

exoA 5-ACATCAAGGTGTTCATCC-3 18 5-GACGAAGAAGGTGGCATC-3 18

oprL 5-TGCGATCACCACCTTCTACTTC-3 22 5-CGCTGACCGCTGCCTTTC-3 18

algD 5-ACGAAGTGGTGGCGAGTTC-3 19 5-TGGTGTGCGGCATGAAGC-3 18

Gene	Forward Primer	Primer length	Reverse Primer	Primer length
exoA	5-ACATCAAGGTGTTCATCC-3	18	5-GACGAAGAAGGTGGCATC-3	18
oprL	5-TGCGATCACCACCTTCTACTTC-3	22	5-CGCTGACCGCTGCCTTTC-3	18
algD	5-ACGAAGTGGTGGCGAGTTC-3	19	5-TGGTGTGCGGCATGAAGC-3	18

2.6 Isolation of Streptomyces having antimicrobial properties

The cross-streak method was used for running the initial screening step. First, Streptomyces strains were cultured vertically on Müller-Hinton agar (Merck) and they were incubated at 28°C for 7 days. Next, the standard strains of P. aeruginosa were cultured in 90 degree-angle relative to Streptomyces. The same procedure was performed for the clinical isolates of P. aeruginosa. The standard sample of P. aeruginosa was obtained from the Iran Scientific and Industrial Research Center and the clinical samples were taken from the Imam Khomeini Hospital Laboratory in Tehran city of Iran.

2.7 Evaluation of the effect of isolated metabolites on exoA and algD gene expression

MIC of P. aeruginosa strains: The serial dilution (microdilution) method was used to determine the minimum inhibitory concentration (MIC) of secondary metabolites from Streptomyces affecting P. aeruginosa. In this step, 100μl from 2048μg/ml concentration of the secondary metabolite, in which 10 ng of the dry secondary metabolite was suspended in 1 ml of DMSO solvent, was used as the initial concentration. The microplate was subsequently incubated at 37°C for 24 h. It was then examined by an ELISA reader at a wavelength of 620 nm [45]. The obtained MIC concentration was used for the treatment to evaluate the gene expression.

RNA extraction: The RNA extraction from P. aeruginosa culture was done by the instructions of Sinaclon Company of Iran. The 24-h culture of colonies were treated with the selected secondary metabolites of Streptomyces strains as well as the untreated colonies of P. aeruginosa were used.

cDNA synthesis: The kit of Parstous Company of Iran was used for doing cDNA synthesis. Based on the instructions, the volume was kept at 20μl. The following steps were successively performed: pre-denaturation at 95°C for 4 min, denaturation at 94°C for 30 s in 35 cycles, annealing at 57°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min.

Quantitative real-time RT-PCR (qRT-PCR): The expression levels of exoA and algD genes were evaluated by the real-time PCR using primers as mentioned in Table 1 [44]. The real-time PCR was performed in a total volume of 20μl consisted of 10μl of 2X green master mix (Yekta Tajhiz Company of Iran), 5 pM of each primer and 1μl of template. The standard conditions were pre-denaturation at 95°C for 15 min, denaturation at 95°C for 20 s in 20 cycles, annealing at 47°C for 30 s, and extension at 72°C for 60 s. The oprL gene transcript was measured as a normalizer to determine the relative transcript of other genes (2^ΔΔCt) [46].

2.8 Methods to detect the metabolite effective on Pseudomonas

Isolation of secondary metabolites by ethyl acetate method: In the first step, pure colonies of Streptomyces isolates were inoculated into 50 ml of ISP2 broth pre-culture medium in a 250 ml flask keeping in 28°C within incubator shaker at 150 (x g) for 48 h. After 48 h, the preculture medium was inoculated into a fermentation medium containing 200 ml of ISP2 broth in 500 ml flasks and they were incubated for 14 days under the same conditions. After the incubation step, the total volume of fermentation medium was centrifuged at 4000 (x g) for 20 min. The obtained supernatant was then stirred with ethyl acetate organic solvent in 1:1 (V/V) ratio on a magnetic stirrer for 2 h, the aqueous and organic phases were separated using a decanter funnel, ethyl acetate was concentrated in an evaporator, the dry metabolite was prepared and stored at -20°C to be used in subsequent experiments [40].

High Performance Liquid Chromatography (HPLC): To isolate the high-purity target compounds, the secondary metabolite of Streptomyces, twenty five strain were selected subjected to HPLC of Shimadzu SCL-10A device in the Iranian Research Institute of Chemistry and Chemical Engineering yielded fifteen different fractions. The C18 column with a diameter of 46×250 mm² was used as the stationary phase. The bacterial metabolite was analyzed using water/acetonitrile system as the mobile phase. The flow rate was 15 ml/min, the fed volume was 1.5 ml and the wavelengths were set at 220 and 260 nm. Fifteen fractions were isolated in this experiment [39].

Liquid Chromatography-Mass Spectrometry (LC-MS): To identify the effective fraction, the LC-MS technique was employed. Accordingly, the Water Alliance 2695 HPLC-Micromass Quattromicro API Mass Spectrometer was used. The desired fractions were separated by the HPLC and they were fed into the LC-MS for mass spectrometry [47].

Fourier Transform Infrared Spectroscopy (FTIR): The infrared spectroscopy was done by a FTIR device of Nexus Model 870 to determine the functional groups of the active substance in the fraction. For this purpose, the desired separated fraction was exposed by the infrared radiation in the range of 4000–400 cm^–1 and it was separated from the sample by running the scanning steps. Finally, the spectroscopic analyses were performed through employing the spectral intensity and absorptions in different regions [37].

Measurement of antimicrobial activity of extracted Streptomyces of twenty five fractions: The disk diffusion method was used for this purpose and a stock (5 mg/ml DMSO) of pure fractions was prepared. The sterile disks (Whatman paper with 6 mm diameter) were impregnated with 10μl of the fractions. The DMSO disk was used as the negative control and the plates were incubated at 37°C for 24 h. The obtained results were then reported by measuring the growth inhibition zone [40 –47].

2.9 16S rRNA sequencing of selected Streptomyces strains

The DNA was extracted from the selected Streptomyces strains by the instructions of Takapouzist Company of Iran using the general primers to isolate and amplify the 16S rRNA gene expressions (Table 2).

Table 2
Primers used for PCR of selected Streptomyces strains

Temperature attachment (°C) Primer sequence (3-5) Primer

60 AAGAGTTTGATCATGGCTCAG 9F

68 AGGAGGTGATCCAACCGCA 1541R

Temperature attachment (°C)	Primer sequence (3-5)	Primer
60	AAGAGTTTGATCATGGCTCAG	9F
68	AGGAGGTGATCCAACCGCA	1541R

The PCR program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s in 32 cycles, annealing at 58°C for 45 s, extension at 72°C for 10 min. After completion of the reaction steps and confirmation of the resulting bands by the Agarose gel electrophoresis, the reaction product was sent to Macrogen Company of South Korea for sequencing and the results were edited using the BioEdit software [48]. Subsequently, the results of alignment with the sequences recorded in NCBI database were compared using the BLAST algorithm and the similarity of 16S rRNA gene sequence was calculated by the EzTaxon-e software [49, 50]. The phylogenetic tree of these isolates was drawn by neighbor joining method and Bootstrap 1000 coefficient was drawn by MEGA6 software [51].

2.10 Statistical analysis

The one-way ANOVA test was used to determine the statistical significance of differences between the groups. All of the experiments were performed in triplicates or more, and the data obtained were expressed as means±SD. P < 0.05 was considered as statistically significant. The calculations were performed by the SPSS software [52].

3 Results and discussion

Fifty five samples were collected from the soils of unspoiled salt caves from Garmsar city of Iran with salinity of 3–20 % and pH of 4.7–-6.9. Thirty five colonies were isolated from the soils, and microscopic and macroscopic studies were performed to confirm them. Colonies with white to brown colors, dry and powdery appearance with soil odor and aerial mycelia under microscope were selected. Gram test and cell wall amino acid assay were performed for initial confirmation, twenty two isolates were confirmed and their antimicrobial effects were investigated.

3.1 Evaluation of biochemical tests and antibiotic susceptibility of P. aeruginosa strains

A total of fifty P. aeruginosa strains were isolated from the clinical samples. In the microscopic examinations, all the isolated strains were gram-negative bacilli that grew well at 42°C and produced green pigmented colonies in Mueller-Hinton agar. Oxidase test, reduction of nitrate and arginine dihydrolase, and oxidation of glucose were positive but lysine decarboxylase and mannitol oxidation were negative in the bacteria. The presence of exoA, algD and oprL genes were evaluated using specific primers in PCR test on fifty nosocomial strains of P. aeruginosa, of which ten of them had all three genes and they were resistant to a variety of antibiotics. In disc diffusion test for nine antibiotics, P. aeroginusa strains were resistant against all the antibiotics derived from isolates No. 33, 1136, 8, 38, 57, 36 and 14; strains No. 49, 1 and 117 were sensitive to Cefepime and Ciprofloxacin disks, strain No. 49 was sensitive to Ceftazidime and strain No. 117 was sensitive to Imipenem, Gentamicin and Amikacin.

As listed in Table 3, Streptomyces No. 25 metabolite had the greatest effect, and it was even effective against P. aeruginosa isolates No. 57, 1136, 33,36, 38,14, and 8, which were resistant to all antibiotics under study and they approved the effectiveness of secondary metabolite taken from Streptomyces No.25.

Table 3
Activity of antimicrobial agent produced by Streptomyces against clinical and standard P. aeruginosa isolates based on the diameter of growth inhibition zone

Mean of inhibition zone diameter (mm)

Strepto-myces sp. Pseudomonas aeruginosa (PTCC: 1310) 49 1 117 38 57 36 14 33 1136 8

2 14.25±0.75 20.25±0.25 ^* 17.50±0.50 20.50±0.50 ^* 13.50±0.50 15.50±0.50 10.00± 0.50 10.00± 0.50 R 12.25± 0.50 R

p < 0.0001 p < 0.0001

25 20.50±0.50^* 21.00± 0.25 19.00±0.25 26.00±0.50 ^* 16.00± 0.25 19.00± 0.50 20.00± 1.50 15.00± 0.50 18.5± 0.50 20.00± 0.50 13.00±1

p < 0.0001 p < 0.0001

19 12.50±0.50 10.00±0.50 R 15.50±0.50 11.50±0.50 10.00±0.50 15.50±0.50 R R 14.25±0.75 R

28 10.50±0.50 13.25±0.75 10.00±1.00 12.25±0.75 10.50±0.50 8.5±0.50 R 10.00± 0.50 10.50± 0.50 11.00± 0.5 R

7 12.00±0.50 15.00±0.50 10.00±0.50 12.25±0.75 10.75±0.75 R 10.00± 0.50 11.00± 0.50 R 12.00± 0.50 R

1 10.00±0.50 R 12.25±0.75 15.00±1.50 10.00±1.00 12.50±0.50 R R 10.25±0.75 15.00±0.50 10.00±0.50

10 13.25±0.25 14.25±0.75 12.00±0.50 19.00±0.50 12.00±0.50 R R R R 10.50±0.50 R

20 15.50±0.50 12.50±0.50 11.00±0.50 12.25±0.50 10.50±0.50 10.0±0.5 11.25±0.75 10.0±0.5 10.0±0.5 R R

21 13.50±0.50 R R 14.25±0.75 12.50±0.50 R R 10.50±0.50 R R 10.50±0.50

22 15.50±0.50 R 11.25±0.75 R 15.50±0.50 11.50±0.50 R 10.25±0.75 11.50±0.50 15.50±0.50 R

23 15.50±0.50 14.50±0.50 12.50±0.50 18.25±0.75 12.00±0.50 R 11.50±0.50 10.00±0.50 R 12.50±0.50 10.50±0.50

24 17.25±0.50 12.50±0.50 R R 12.75±0.50 13.50±0.50 R 14.00±0.50 12.50±0.50 R 10.00±0.50

34 12.25±0.25 10.50±0.50 R 13.25±0.25 13.00±0.50 R R 10.25±0.50 R 10.00±0.50 R

36 14.25±0.25 11.25±0.50 15.25±0.75 R R 12.50±0.50 R 10.25±0.50 R R R

52 14.00±0.50 14.25±0.75 11.50±0.50 10.50±0.50 14.00±0.50 R 11.50±0.50 R 11.50±0.50 15.50±0.50 R

3 15.50±0.50 10.50±0.50 17.25±0.50 11.50±0.50 12.50±0.50 14.00±0.50 R R 10.50±0.50 R 10.50±0.50

44 11.50±0.50 17.25±0.50 R 11.50±0.50 12.50±0.50 R R 10.25±0.75 R 15.50±0.50 R

29 14.50±0.50 10.50±0.50 R 12.50±0.50 15.50±0.50 R R 12.50±0.50 10.50±0.50 R R

47 10.50±0.50 R 10.00±0.50 15.50±0.50 R 17.25±0.50 R R 15.50±0.50 11.50±0.50 R

13 12.75±0.50 R 10.50±0.50 10.00±1.50 10.00±0.50 R 15.50±0.50 14.00±0.50 R 15.50±0.50 R

8 15.50±0.50 15.00±0.50 10.50±0.50 11.50±0.50 R 10.00±0.50 R 10.00±0.50 R 8.5±0.50 10.00±0.50

5 10.00±0.50 14.50±0.50 R 11.50±0.50 15.50±0.50 R R 11.50±0.50 8.50±0.50 13.25±0.25 8.5±0.50

		Mean of inhibition zone diameter (mm)
2	14.25±0.75	20.25±0.25 ^*	17.50±0.50	20.50±0.50 ^*	13.50±0.50	15.50±0.50	10.00± 0.50	10.00± 0.50	R	12.25± 0.50	R
		p < 0.0001		p < 0.0001
25	20.50±0.50^*	21.00± 0.25	19.00±0.25	26.00±0.50 ^*	16.00± 0.25	19.00± 0.50	20.00± 1.50	15.00± 0.50	18.5± 0.50	20.00± 0.50	13.00±1
	p < 0.0001			p < 0.0001
19	12.50±0.50	10.00±0.50	R	15.50±0.50	11.50±0.50	10.00±0.50	15.50±0.50	R	R	14.25±0.75	R
28	10.50±0.50	13.25±0.75	10.00±1.00	12.25±0.75	10.50±0.50	8.5±0.50	R	10.00± 0.50	10.50± 0.50	11.00± 0.5	R
7	12.00±0.50	15.00±0.50	10.00±0.50	12.25±0.75	10.75±0.75	R	10.00± 0.50	11.00± 0.50	R	12.00± 0.50	R
1	10.00±0.50	R	12.25±0.75	15.00±1.50	10.00±1.00	12.50±0.50	R	R	10.25±0.75	15.00±0.50	10.00±0.50
10	13.25±0.25	14.25±0.75	12.00±0.50	19.00±0.50	12.00±0.50	R	R	R	R	10.50±0.50	R
20	15.50±0.50	12.50±0.50	11.00±0.50	12.25±0.50	10.50±0.50	10.0±0.5	11.25±0.75	10.0±0.5	10.0±0.5	R	R
21	13.50±0.50	R	R	14.25±0.75	12.50±0.50	R	R	10.50±0.50	R	R	10.50±0.50
22	15.50±0.50	R	11.25±0.75	R	15.50±0.50	11.50±0.50	R	10.25±0.75	11.50±0.50	15.50±0.50	R
23	15.50±0.50	14.50±0.50	12.50±0.50	18.25±0.75	12.00±0.50	R	11.50±0.50	10.00±0.50	R	12.50±0.50	10.50±0.50
24	17.25±0.50	12.50±0.50	R	R	12.75±0.50	13.50±0.50	R	14.00±0.50	12.50±0.50	R	10.00±0.50
34	12.25±0.25	10.50±0.50	R	13.25±0.25	13.00±0.50	R	R	10.25±0.50	R	10.00±0.50	R
36	14.25±0.25	11.25±0.50	15.25±0.75	R	R	12.50±0.50	R	10.25±0.50	R	R	R
52	14.00±0.50	14.25±0.75	11.50±0.50	10.50±0.50	14.00±0.50	R	11.50±0.50	R	11.50±0.50	15.50±0.50	R
3	15.50±0.50	10.50±0.50	17.25±0.50	11.50±0.50	12.50±0.50	14.00±0.50	R	R	10.50±0.50	R	10.50±0.50
44	11.50±0.50	17.25±0.50	R	11.50±0.50	12.50±0.50	R	R	10.25±0.75	R	15.50±0.50	R
29	14.50±0.50	10.50±0.50	R	12.50±0.50	15.50±0.50	R	R	12.50±0.50	10.50±0.50	R	R
47	10.50±0.50	R	10.00±0.50	15.50±0.50	R	17.25±0.50	R	R	15.50±0.50	11.50±0.50	R
13	12.75±0.50	R	10.50±0.50	10.00±1.50	10.00±0.50	R	15.50±0.50	14.00±0.50	R	15.50±0.50	R
8	15.50±0.50	15.00±0.50	10.50±0.50	11.50±0.50	R	10.00±0.50	R	10.00±0.50	R	8.5±0.50	10.00±0.50
5	10.00±0.50	14.50±0.50	R	11.50±0.50	15.50±0.50	R	R	11.50±0.50	8.50±0.50	13.25±0.25	8.5±0.50

3.2 Expression of algD and exoA genes by quantitative real-time RT-PCR (qRT-PCR) in Pseudomonas isolates treated with secondary metabolites of Streptomyces 25

MIC of secondary metabolites for P. aeruginosa strains was 1024μg/ml. P. aeruginosa samples were treated with Streptomyces No. 25 metabolite and the expression of exoA and algD genes were measured before and after the treatment (Fig. 1). The results showed that the treated Streptomyces No. 25 metabolite strain significantly reduced the expression of algD and exoA genes in Pseudomonas strains No. 1136 and 57 (p < 0.01).

Fig. 1

Effect of Streptomyces sp.25 on P. aeruginosa isolates gene expression. (a) Quantitative real-time PCR analysis of algD marker. (b) Quantitative real-time PCR for exoA marker after 24h treatment with 1024μg/mL metabolites concentration. ^*: p < 0.001.

3.3 Results of HPLC from Streptomyces No. 25 metabolite

After HPLC, fifteen different fractions were isolated (Fig. 2). The antimicrobial effect of each fraction on all ten samples of P. aeruginosa and standard sample were examined by disk diffusion method. Fraction 3 had the highest antimicrobial effect and was selected as the fraction because of the likelihood of containing the biologically active agent.

Fig. 2

HPLC analysis of Streptomyces 25 metabolite. Each graph shows the separation of the fractions of metabolite no 25 at different times (all 15 fractions were marked based on the separation time).

3.4 FTIR analysis

FTIR spectra of the isolated fraction had a peak point at 1665 cm^–1 indicating the C = O functional group and another peak point at 1207 cm^–1 showing the C-O functional group, as well as the peak at 2900 cm^–1 revealing the C-H functional group (Fig. 3).

Fig. 3

FTIR analysis of fraction No. 3.

3.5 Identification of the effective agent of fraction 3 by LC-Mass Spectrometry

Considering breaks 249 and 227 in LC-MS (Fig. 4) and the agreement with previous studies, the active agent could be the Isobutyl nonactin analog of Macrotetrolide Ionophore antibiotic (Nonactin) with functional groups R1 methyl, R2 ethyl, R3 isobutyl and R4 isobutyl (Fig. 5) containing an active agent against clinical P. aeruginosa isolates [47].

Fig. 4

LC-Mass Spectrometry test of fraction No. 3.

Fig. 5

Macrotetrolide structure (R1 methyl, R2 ethyl, R3 isobutyl, R4 isobutyl).

3.6 Identification of selected strains of Streptomyces

Physiological and biochemical characteristics of selected isolate were summarized in Table 4 and its microscopic and macroscopic morphology were also shown in Fig. 6. The phylogenetic positions of these strains were determined based on 16S rRNA gene sequence (1445 bp). The alignment of these sequences with those recorded in the NCBI database revealed that Streptomyces No. 25 is 95.4 % similar to S. tunisiensis (Fig. 7); S. tunisiensis (GenBank accession number: SUB7473271 nk25 MT490243). Gene registration of this isolate was also performed.

Table 4
Morphological and biochemical characteristics of selected Streptomyces number 25

Characteristics Streptomyces No.25

Aerial mass color on ISP2 Gray

Substrate mycelium on ISP2 Branched

Gram stain +

Temperature optimum (°C) 28

pH optimum 6.4

Nitrate reduction –

Catalase +

Whole-cell hydrolysates LL-diaminopimelic acid^* +

Casein hydrolysis +

Starch hydrolysis +

Citrate utilization +

Mannitol utilization –

Trehalose utilization +

Maltose utilization –

Characteristics	Streptomyces No.25
Aerial mass color on ISP2	Gray
Substrate mycelium on ISP2	Branched
Gram stain	+
Temperature optimum (°C)	28
pH optimum	6.4
Nitrate reduction	–
Catalase	+
Whole-cell hydrolysates LL-diaminopimelic acid^*	+
Casein hydrolysis	+
Starch hydrolysis	+
Citrate utilization	+
Mannitol utilization	–
Trehalose utilization	+
Maltose utilization	–

Fig. 6

Macroscopic and Microscopic image of Streptomyces No. 25.

Fig. 7

Phylogenetic tree of Streptomyces number 25. Phylogenetic relationships between16S rRNA sequence of strains and other relevant bacterial sequences. The scale bar corresponds to estimated 10% difference in nucleotide sequence positions.

Over the years, drug-resistant microorganisms have become highly prevalent [53]. With the discovery of Penicillin in 1928, it was believed that all diseases caused by pathogenic bacteria could be easily controlled, but this was not the case and physicians were confronted with resistant strains of bacteria from 1950s [54]. Therefore, the diseases caused by such bacteria became a serious problem and a major threat worldwide. P. aeruginosa is one of the most important pathogenic bacteria that is resistant to any treatment [2]. This bacterium is of high importance both in terms of pathogenicity and drug resistance [3]. In recent years, growing attentions have been focused on producing pharmaceutical compounds such as antimicrobials from the naturally available resources and plants [55 –60]. Metabolites from Streptomyces are most important among these natural sources [9]. Streptomyces strains living in extreme environments such as saline environments are more likely to produce molecules and compounds different from other non-halophilic organisms [61]. Few studies have been conducted on the secondary metabolites of halophiles, and it seems that the compounds could be seen as essential resources for producing new antimicrobial agents and treatment of diseases such as cancer [53]. Accordingly, exploring effective compounds against clinical Pseudomonas strains having exoA and alg D pathogenic genes were investigated in this work. The mentioned genes are important in the pathogenesis of the targeted bacterium and they are directly related to the antibiotic resistance [62, 63]. During the current research work, twenty two Streptomyces isolates were recovered from saline soils of Garmsar caves, among which isolate No. 25 (S. tunesiensis) had a salinity tolerance of 15 % and its secondary metabolite was effective against all ten Pseudomonas isolates that showing multidrug resistance (Table 3). The results indicated that the secondary metabolites of this bacterium had the ability to reduce the expression of exoA and algD genes in a concentration of 1024μg/ml (Fig. 1). In available resources, the antibacterial, antifungal, and antiviral properties of this bacterium have been demonstrated [64]. The effect of Streptomyces antimicrobials was seen to be related to the concentration of these compounds [53].

In 2019, Kalyani and co-workers [65] isolated Streptomyces sp. NLKPB45 from the soil of mangrove shrubs in Nellore, Andhra Pradesh of India, and they assessed the antimicrobial activity of its secondary metabolite extracted by ethyl acetate method on a number of gram-positive and gram-negative bacteria. In another study in 2019, Riahi and co-workers [66] isolated that pure ethyl acetate extract of Streptomyces sp. AR2 from wet and saline soils with the antimicrobial effect against B. subtilis, B. megaterium, B. cereus, M. luteus, S. aureus gram-positive bacteria with MIC values ranging from 5 to 50μg/ml. Comparing the results of current work and those from the earlier works could show benefit of the secondary metabolite of S. tunesiensis for yielding effective antibiotics with high efficiency. To this end, the secondary metabolite of S. tunesiensis (Streptomyces No. 25) was subjected to the HPLC test to isolate the high-purity target compounds, in which fifteen different fractions were extracted with the highest antimicrobial effect for the fraction No. 3. Moreover, the FTIR experiments were performed to determine the functional groups of the active agents in fraction No. 3 showing peaks at 1665, 1207, and 2900 cm^–1 indicating the existence of C = O, C–O, C–H functional groups, respectively. These achievement were in agreement with the results of Kumar and co-workers [61]. The LC-MS test was performed to examine the biologically active agent and to identify its molecular structure. By observing peaks at 249 and 227 in the LC-MS diagram and based on the research by Řezanka and co-workers [47], the active compound in fraction No. 3 could be the isobutyl nonactin analog with the antimicrobial effect against P. aeruginosa. Isobutyl nonactin is an analog of macrotetrolide family of antibiotics (polynactin), which is present in secondary metabolites of various Streptomyces species involving a wide range of biological activities such as antimicrobial [47, 67]. In another study by Crevelin and co-workers [68], analyzing the extract produced by Streptomyces sp. AMC 23 by UPLC-MS/MS led to the detection of seven macrotetrolide compounds. We could suggest that the identified agent of present study belonged to the family of Macrotetrolides with antimicrobial effect on MDR Pseudomonas. In a study conducted by Sharma and co-workers [37], Streptomyces antibioticus strain M7 was isolated from Palampur and Himachal Pradesh soils of India and their secondary metabolites showed strong antibacterial effect on S. aureus, E. coli, S. epidermidis, B. subtilis, MRSA and VRE (Vancomycin-resistant Enterococcus). Further analysis of their secondary metabolites by HPLC, FTIR, NMR, and LC-MS techniques revealed the presence of Actinomycin V, D, X2 in the active substance showing higher potency of Actinomycin X2 on the studied bacteria than two other D and V types [37]. Additionally, Lu and co-workers [69] isolated two lancacidine-related metabolites from Streptomyces sp. HS-NF-1178 fermentation fluid with strong antitumor activity based on spectroscopic analyses including NMR and ESI-MS. In another study by Fatima and co-workers [70], they isolated Streptomyces KM2 from the saline soil of Khewra of Pakistan, in which they extracted the secondary metabolite using ethyl acetate besides investigating its antitumor effects and identifying the pranoe1,2,3 trial-(1H-indol3yl) pure compound. S. californicus strain ADR1 was isolated by Singh and co-workers [71] showing antimicrobial, anti-biofilm, and antioxidant effect of secondary metabolites measured. Hence, isolating and screening Streptomyces from unspoiled areas and identification of new biologically active agents in their secondary metabolites could prevent the spread of microbial infections and antibiotic resistance.

4 Conclusion

The achievements of this study showed that the isolated Streptomyces strains from the soil of salt caves of Garmsar had the ability to produce antimicrobials against the clinical strains of P. aeruginosa. The accurate identification and determination of molecular structures of effective biomaterials could help to produce new antibiotics for controlling diseases caused by resistant strains of bacteria. In this regard, the current achievements showed benefits of exploring new compounds from naturally available resources for doing functions in biological related systems. Indeed, the drug resistance of diseases could lead to increase the importance of performing such works of producing novel compounds.

References

Malhotra

, Hayes

Jr and Wozniak

D.J.

, Cystic fibrosis and Pseudomonas aeruginosa: the host-microbe interface, Clinical Microbiology Reviews 32 (2019), e00138.

Al-Wrafy

, Brzozowska

, Górska

and Gamian

, Pathogenic factors of Pseudomonas aeruginosa–the role of biofilm in pathogenicity and as a target for phage therapy, Postepy Higieny i Medycyny Doswiadczalnej 70 (2016), 78–91.

Alhazmi

, Pseudomonas aeruginosa-pathogenesis and pathogenic mechanisms, International Journal of Biology 7 (2015), 44.

Michalska

and Wolf

, Pseudomonas Exotoxin A: optimized by evolution for effective killing, Frontiers in Microbiology 6 (2015), 963.

Kipnis

, Sawa

and Wiener-Kronish

, Targeting mechanisms of Pseudomonas aeruginosa pathogenesis, Medecine et Maladies Infectieuses 36 (2006), 78–91.

Johansen

H.K.

, Moskowitz

S.M.

, Ciofu

, Pressler

and Høiby

, Spread of colistin resistant non-mucoid Pseudomonas aeruginosa among chronically infected Danish cystic fibrosis patients, Journal of Cystic Fibrosis 7 (2008), 391–397.

Sacha

, Wieczorek

, Hauschild

, Zórawski

, Olszańska

and Tryniszewska

, Metallo-beta-lmases of Pseudomonas aeruginosa–a novel mechanism resistance to beta-lactam antibiotics, Folia Histochemica et Cytobiologica 46 (2008), 137–142.

Pang

, Raudonis

, Glick

B.R.

, Lin

T.J.

and Cheng

, Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies, Biotechnology Advances 37 (2019), 177–192.

Zhou

L.F.

, Wu

, Li

, Jin

L.P.

, Yin

C.P.

and Zhang

Y.L.

, Antibacterial potential of termite-associated Streptomyces spp, ACS Omega 6 (2021), 4329–4334.

10.

Pham

V.T.

, Nguyen

C.T.

, Dhakal

, Nguyen

H.T.

, Kim

T.S.

and Sohng

J.K.

, Recent advances in the heterologous biosynthesis of natural products from Streptomyces, Applied Sciences 11 (2021), 1851.

11.

Zhao

, Zhang

, Yu

, Liu

, Zhang

, Yao

, Feng

, Liu

, Yu

, Ma

and Qin

, Discovery of thiosemicarbazone derivatives as effective New Delhi metallo-β-lactamase-1 (NDM-1) inhibitors against NDM-1 producing clinical isolates, Acta Pharmaceutica Sinica B 11 (2021), 203–221.

12.

Feng

, Chen

, Sun

and Wang

, Microbial induced calcium carbonate precipitation study using Bacillus subtilis with application to self-healing concrete preparation and characterization, Construction and Building Materials 280 (2021), 122460.

13.

Zhang

, Chao

L.J.

, Wang

Q.Q.

, Huang

Y.C.

, Liu

R.H.

, Hong

, Tu

, Qu

and Ye

J.Y.

, Using multi-satellite microwave remote sensing observations for retrieval of daily surface soil moisture across China, Water Science and Engineering 12 (2019), 85–97.

14.

, Peng

, Ding

, Cui

, Nie

and Yan

, Purification, structure and biological activity of pumpkin polysaccharides: a review, Food Reviews International 2021; in press.

15.

, Wei

, Lou

, Shu

and Chen

, A Critical review on communication mechanism within plant-endophytic fungi interactions to cope with biotic and abiotic stresses, Journal of Fungi 7 (2021), 719.

16.

Miao

, Liu

, Wu

, Wang

, Liu

, Miao

, Yang

, Guo

and Ma

, Effects of long-term grazing exclusion on plant and soil properties vary with position in dune systems in the Horqin Sandy Land, Catena 209 (2022), 105860.

17.

, Wang

X.Y.

, Liu

C.N.

, Chen

J.N.

and Zhang

, A 3D root system morphological and mechanical model based on L-Systems and its application to estimate the shear strength of root-soil composites, Soil and Tillage Research 212 (2021), 105074.

18.

Pattnayak

, Kumar

, Sahu

S.C.

, Dhal

N.K.

and Behera

R.K.

, Comparison of soil characteristics and carbon content of contrastingly different moist-mixed deciduous and evergreen mangrove forest in Odisha, India, Geology, Ecology, and Landscapes 3 (2019), 239–246.

19.

Zhang

, Ali

, Antonarakis

, Moghaddam

, Saatchi

, Tabatabaeenejad

, Chen

, Jaruwatanadilok

, Cuenca

, Crow

W.T.

and Moorcroft

, The sensitivity of North American terrestrial carbon fluxes to spatial and temporal variation in soil moisture: An analysis using radar-derived estimates of root-zone soil moisture, Journal of Geophysical Research: Biogeosciences 124 (2019), 3208–3231.

20.

Tang

, Wu

, Zhang

, Chen

and Li

, Competitive-type pressure-dependent immunosensor for highly sensitive detection of diacetoxyscirpenol in wheat via monoclonal antibody, Analytical Chemistry 92 (2020), 3563–3571.

21.

Z.F.

, Song

, Xu

X.L.

, Ma

and Lu

, Sources, migration, accumulation and influence of microplastics in terrestrial plant communities, Environmental and Experimental Botany 192 (2021), 104635.

22.

Paramasivam

C.R.

and Anbazhagan

, Soil fertility analysis in and around magnesite mines, Salem, India, Geology, Ecology, and Landscapes 4 (2020), 140–150.

23.

, Lan

, Ren

, Zhou

, Wang

and Yuan

, Modeling of coupled transfer of water, heat and solute in saline loess considering sodium sulfate crystallization, Cold Regions Science and Technology 189 (2021), 103335.

24.

Dehkordi

F.S.

, Valizadeh

, Birgani

T.A.

and Dehkordi

K.G.

, Prevalence study of Brucella melitensis and Brucella abortus in cow’s milk using dot enzyme linked immuno sorbent assay and duplex polymerase chain reaction, Journal of Pure and Applied Microbiology 8 (2014), 1065–1069.

25.

Emamikhah

, Jamali

and Kazerooni

, Friction stir welding of CuZn40 brass alloy based on optimal response surface results: numerical and experimental analyses, Advanced Journal of Science and Engineering 2 (2021), 3–17.

26.

Dehkordi

F.S.

, Yazdani

, Mozafari

and Valizadeh

, Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products, BMC Research Notes 7 (2014), 1–8.

27.

Dehkordi

F.S.

, Prevalence study of Bovine viral diarrhea virus by evaluation of antigen capture ELISA and RT-PCR assay in Bovine, Ovine, Caprine, Buffalo and Camel aborted fetuses in Iran, AMB Express 1 (2011), 1–6.

28.

Dehkordi

F.S.

, Barati

, Momtaz

, Ahari

S.N.

and Dehkordi

S.N.

, Comparison of shedding, and antibiotic resistance properties of Listeria monocytogenes isolated from milk, feces, urine, and vaginal secretion of bovine, ovine, caprine, buffalo, and camel species in Iran, Jundishapur Journal of Microbiology 6 (2013), 284.

29.

Dehkordi

F.S.

, Haghighi

M.R.

, Borujeni Rahimi

and Abdizadeh,

, Detection of Toxoplasma gondii in raw caprine, ovine, buffalo, bovine, and camel milk using cell cultivation, cat bioassay, capture ELISA, and PCR methods in Iran, Foodborne Pathogens and Disease 10 (2013), 120–125.

30.

Tatar

, Isolation, phylogenetic analysis and antimicrobial activity of halophilic actinomycetes from different saline environments located near Çorum province, Biologia 76 (2021), 773–780.

31.

Vasavada

S.H.

, Thumar

J.T.

and Singh

S.P.

, Secretion of a potent antibiotic by salt-tolerant and alkaliphilic actinomycete Streptomyces sannanensis strain RJT-1, Current Science 91 (2006), 1393–1397.

32.

Akram

, Siddique

, Laila

, Ghotekar

, Pagar

and Oza

, Traditional use, phytochemistry and pharmacology of Genus sesbania: a review, Advanced Journal of Science and Engineering 2 (2021), 64–68.

33.

Rezaee

, Kermani

, Ejlali

, Biniyazan

and Soleimanimehr

, Nanoparticle concentration and heat treatment effects on microstructure and tribological behavior of the Ni-P nanocomposite coating, Advanced Journal of Science and Engineering 2 (2021), 71–78.

34.

Harismah

, Ariningrum

N.D.

, Fuadi

A.M.

, Mujiburohman

and Mirzaei

, Formulation and evaluation of herbal hand sanitizer based on stevia (Stevia rebaudiana), Journal of Physics: Conference Series 1858 (2021), 012053.

35.

Mirzaei

, Kalhor

H.R.

and Hadipour

N.L.

, Covalent hybridization of CNT by thymine and uracil: A computational study, Journal of Molecular Modeling 17 (2011), 695–699.

36.

Ghanadian

, Ali

, Khan

I.A.

, Balachandran

, Nikahd

, Aghaei

, Mirzaei

and Sajjadi

S.E.

, A new sesquiterpenoid from the shoots of Iranian Daphne mucronata Royle with selective inhibition of STAT3 and Smad3/4 cancer-related signaling pathways, DARU Journal of Pharmaceutical Sciences 28 (2020), 253–262.

37.

Sharma

and Manhas

R.K.

, Purification and characterization of actinomycins from Streptomyces strain M7 active against methicillin resistant Staphylococcus aureus and vancomycin resistant Enterococcus, BMC Microbiology 19 (2019), 1–14.

38.

Suutari

, Lignell

, Hyvärinen

and Nevalainen

, Media for cultivation of indoor streptomycetes, Journal of Microbiological Methods 51 (2002), 411–416.

39.

Sebak

, Saafan

A.E.

, Abdelghani

, Bakeer

, Moawad

A.S.

and El-Gendy

A.O.

, Isolation and optimized production of putative antimicrobial compounds from Egyptian soil isolate Streptomyces sp. MS. 10, Beni-Suef University Journal of Basic and Applied Sciences 10 (2021), 1–12.

40.

Saadouli

, Zendah

, Euch

, Trabelsi

, Mosbah

, Redissi

, Ferjani

, Fhoula

, Cherif

, Sabatier

J.M.

, Sewald

and Ouzari

H.I.

, Isolation, characterization and chemical synthesis of large spectrum antimicrobial cyclic dipeptide (l-leu-l-pro) from Streptomyces misionensis V16R3Y1 bacteria extracts. a novel 1H NMR metabolomic approach, Antibiotics 9 (2020), 270.

41.

Kämpfer

and Kroppenstedt

R.M.

, Probabilistic identification of streptomycetes using miniaturized physiological tests, Microbiology 137 (1991), 1893–1902.

42.

Sun

, Wang

, Hu

, Zhou

, Ye

and Zeng

, Changes in molecular structure of chickpea starch during processing treatments: A thin layer chromatography study, Food Chemistry 243 (2018), 186–191.

43.

Makiani

M.J.

, Farasatinasab

, Bemani

, Moghadam

H.N.

, Sheibani

, Meidanshahi

A.V.

, Sedighi

and Shahi

, Sensitivity of Acinetobacter baumannii and Pseudomonas aeruginosa microorganisms to colistin antibiotic by MIC (E-test) in Patients admitted to the intensive care unit of Firoozgar hospital, Journal of Pharmaceutical Care 8 (2020), 143–147.

44.

Taee

S.R.

, Khansarinejad

, Abtahi

, Najafimosleh

and Ghaznavi-Rad

, Detection of algD, oprL and exoA genes by new specific primers as an efficient, rapid and accurate procedure for direct diagnosis of Pseudomonas aeruginosa strains in clinical samples, Jundishapur Journal of Microbiology 7 (2014), 13583.

45.

Lepak

A.J.

, Reda

, Marchillo

, Van Hecker

, Craig

W.A.

and Andes

, Impact of MIC range for Pseudomonas aeruginosa and Streptococcus pneumoniae on the ceftolozane in vivo pharmacokinetic/pharmacodynamic target, Antimicrobial Agents and Chemotherapy 58 (2014), 6311–6314.

46.

Al-Kafaween

M.A.

, Hilmi

A.B.

, Al-Jamal

H.A.

, Elsahoryi

N.A.

, Jaffar

and Zahri

M.K.

, Pseudomonas aeruginosa and Streptococcus pyogenes exposed to Malaysian trigona honey in vitro demonstrated downregulation of virulence factor, Iranian Journal of Biotechnology 18 (2020), 2542.

47.

Řezanka

, Prell

, Spížek

and Sigler

, Pilot-plant cultivation of Streptomyces griseus producing homologues of nonactin by precursor-directed biosynthesis and their identification by LC/MS-ESI, The Journal of Antibiotics 63 (2010), 524–529.

48.

Hall

, Biosciences

and Carlsbad

, BioEdit: an important software for molecular biology, GERF Bulletin of Bioscience 2 (2011), 60–61.

49.

Geer

L.Y.

, Marchler-Bauer

, Geer

R.C.

, Han

, He

, Liu

, Shi

and Bryant

S.H.

, The NCBI biosystems database, Nucleic Acids Research 38 (2010), 492–496.

50.

Larkin

M.A.

, Blackshields

, Brown

N.P.

, Chenna

, McGettigan

P.A.

, McWilliam

, Valentin

, Wallace

I.M.

, Wilm

, Lopez

and Thompson

J.D.

, Clustal W and Clustal X version 2.0, Bioinformatics 23 (2007), 2947–2948.

51.

Tamura

, Stecher

, Peterson

, Filipski

and Kumar

, MEGA6: molecular evolutionary genetics analysis version 6.0, Molecular Biology and Evolution 30 (2013), 2725–2729.

52.

Frey

, SPSS (software), The International Encyclopedia of Communication Research Methods (2017), 1–12.

53.

Dougan

, Dowson

, Overington

and Participants

N.G.

, Meeting the discovery challenge of drug-resistant infections: progress and focusing resources, Drug Discovery Today 24 (2019), 452–461.

54.

Vouga

and Greub

, Emerging bacterial pathogens: the past and beyond, Clinical Microbiology and Infection 22 (2016), 12–21.

55.

Henry

E.J.

, Bird

S.J.

, Gowland

, Collins

and Cassella

J.P.

, Ferrocenyl chalcone derivatives as possible antimicrobial agents, The Journal of Antibiotics 73 (2020), 299–308.

56.

Mirzaei

and Nazemi

, In silico interactions between curcumin derivatives and monoamine oxidase-a enzyme, Biointerface Research in Applied Chemistry 12 (2022), 3752–3761.

57.

Mirzaei

, Harismah

, Soleimani

and Mousavi

, Inhibitory effects of curcumin on aldose reductase and cyclooxygenase-2 enzymes, Journal of Biomolecular Structure and Dynamics 39 (2021), 6424–6430.

58.

Gilani

A.G.

, Taghvaei

, Rufchahi

E.M.

and Mirzaei

, Tautomerism, solvatochromism, preferential solvation, and density functional study of some heteroarylazo dyes, Journal of Molecular Liquids 273 (2019), 392–407.

59.

Idris

M.O.

, Adeniji

S.E.

, Habib

and Adeiza

A.A.

, Molecular docking of some novel quinoline derivatives as potent inhibitors of human breast cancer cell line, Lab-in-Silico 2 (2021), 30–37.

60.

Aghaei

, Mirzaei

, Ghanadian

, Fallah

and Mahboodi

, 6-Methoxylated flavonoids: jacein, and 3-demethyljacein from Centaurea schmidii with their endoplasmic reticulum stress and apoptotic cell death in breast Ccancer cells along with in-silico analysis, Iranian Journal of Pharmaceutical Research 20 (2021), 417–432.

61.

Kumar

, Gusain

, Thakur

R.L.

and Bisht

G.S.

, Isolation, purification and partial characterization of an antibacterial agent produced by halotolerant alkaliphilic Streptomyces sp. EWC 7 (2). Proceedings of the National Academy of Sciences, India Section B: Biological Sciences 83 (2013), 199–206.

62.

Ghazalibina

, Morshedi

, Farahani

R.K.

, Babadi

and Khaledi

, Study of virulence genes and related with biofilm formation in Pseudomonas aeruginosa isolated from clinical samples of Iranian patients; a systematic review, Gene Reports 17 (2019), 100471.

63.

Georgescu

, Gheorghe

, Curutiu

, Lazar

, Bleotu

and Chifiriuc

M.C.

, Virulence and resistance features of Pseudomonas aeruginosa strains isolated from chronic leg ulcers, BMC Infectious Diseases 16 (2016), 92.

64.

Slama

, Mankai

, Ayed

, Mezhoud

, Rauch

, Lazim

, Barkallah

, Gtari

and Limam

, Streptomyces tunisiensis sp. nov., a novel Streptomyces species with antibacterial activity, Antonie van Leeuwenhoek 105 (2014), 377–387.

65.

Kalyani

B.S.

, Krishna

P.S.

and Sreenivasulu

, Screening and identification of novel isolate Streptomyces sp., NLKPB45 from Nellore costal region for its biomedical applications, Saudi Journal of Biological Sciences 26 (2019), 1655–1660.

66.

Riahi

, Hosni

, Raies

and Oliveira

, Unique secondary metabolites of a Streptomyces strain isolated from extreme salty wetland show antioxidant and antibacterial activities, Journal of Applied Microbiology 127 (2019), 1727–1740.

67.

Takai

, Hanadate

, Abe

, Ono

, Yamada

, Kuwahara

and Kiyota

, Synthesis of macrotetrolide α, a designed polynactin analog composed of bishomononactic acids, Tetrahedron 67 (2011), 7066–7072.

68.

Crevelin

E.J.

, Crotti

A.E.

, Zucchi

T.D.

, Melo

I.S.

and Moraes

L.A.

, Dereplication of Streptomyces sp. AMC 23 polyether ionophore antibiotics by accurate-mass electrospray tandem mass spectrometry, Journal of Mass Spectrometry 49 (2014), 1117–1126.

69.

, Li

J.M.

, Qi

, Zhang

, Xiang

W.S.

, Wang

J.D.

and Wang

X.J.

, Two new lankacidin-related metabolites from Streptomyces sp. HS-NF-, The Journal of Antibiotics 71 (2018), 397–401.

70.

Fatima

, Aftab

, Shaaban

K.A.

, Thorson

J.S.

and Sajid

, Spore forming Actinobacterial diversity of Cholistan Desert Pakistan: Polyphasic taxonomy, antimicrobial potential and chemical profiling, BMC Microbiology 19 (2019), 1–7.

71.

Singh

and Dubey

A.K.

, Isolation and characterization of a new endophytic actinobacterium Streptomyces californicus strain ADR1 as a promising source of anti-bacterial, anti-biofilm and antioxidant metabolites, Microorganisms 8 (2020), 929.

		Mean of inhibition zone diameter (mm)
Strepto-myces sp.	Pseudomonas aeruginosa (PTCC: 1310)	49	1	117	38	57	36	14	33	1136	8
2	14.25±0.75	20.25±0.25 ^*	17.50±0.50	20.50±0.50 ^*	13.50±0.50	15.50±0.50	10.00± 0.50	10.00± 0.50	R	12.25± 0.50	R
		p < 0.0001		p < 0.0001
25	20.50±0.50^*	21.00± 0.25	19.00±0.25	26.00±0.50 ^*	16.00± 0.25	19.00± 0.50	20.00± 1.50	15.00± 0.50	18.5± 0.50	20.00± 0.50	13.00±1
	p < 0.0001			p < 0.0001
19	12.50±0.50	10.00±0.50	R	15.50±0.50	11.50±0.50	10.00±0.50	15.50±0.50	R	R	14.25±0.75	R
28	10.50±0.50	13.25±0.75	10.00±1.00	12.25±0.75	10.50±0.50	8.5±0.50	R	10.00± 0.50	10.50± 0.50	11.00± 0.5	R
7	12.00±0.50	15.00±0.50	10.00±0.50	12.25±0.75	10.75±0.75	R	10.00± 0.50	11.00± 0.50	R	12.00± 0.50	R
1	10.00±0.50	R	12.25±0.75	15.00±1.50	10.00±1.00	12.50±0.50	R	R	10.25±0.75	15.00±0.50	10.00±0.50
10	13.25±0.25	14.25±0.75	12.00±0.50	19.00±0.50	12.00±0.50	R	R	R	R	10.50±0.50	R
20	15.50±0.50	12.50±0.50	11.00±0.50	12.25±0.50	10.50±0.50	10.0±0.5	11.25±0.75	10.0±0.5	10.0±0.5	R	R
21	13.50±0.50	R	R	14.25±0.75	12.50±0.50	R	R	10.50±0.50	R	R	10.50±0.50
22	15.50±0.50	R	11.25±0.75	R	15.50±0.50	11.50±0.50	R	10.25±0.75	11.50±0.50	15.50±0.50	R
23	15.50±0.50	14.50±0.50	12.50±0.50	18.25±0.75	12.00±0.50	R	11.50±0.50	10.00±0.50	R	12.50±0.50	10.50±0.50
24	17.25±0.50	12.50±0.50	R	R	12.75±0.50	13.50±0.50	R	14.00±0.50	12.50±0.50	R	10.00±0.50
34	12.25±0.25	10.50±0.50	R	13.25±0.25	13.00±0.50	R	R	10.25±0.50	R	10.00±0.50	R
36	14.25±0.25	11.25±0.50	15.25±0.75	R	R	12.50±0.50	R	10.25±0.50	R	R	R
52	14.00±0.50	14.25±0.75	11.50±0.50	10.50±0.50	14.00±0.50	R	11.50±0.50	R	11.50±0.50	15.50±0.50	R
3	15.50±0.50	10.50±0.50	17.25±0.50	11.50±0.50	12.50±0.50	14.00±0.50	R	R	10.50±0.50	R	10.50±0.50
44	11.50±0.50	17.25±0.50	R	11.50±0.50	12.50±0.50	R	R	10.25±0.75	R	15.50±0.50	R
29	14.50±0.50	10.50±0.50	R	12.50±0.50	15.50±0.50	R	R	12.50±0.50	10.50±0.50	R	R
47	10.50±0.50	R	10.00±0.50	15.50±0.50	R	17.25±0.50	R	R	15.50±0.50	11.50±0.50	R
13	12.75±0.50	R	10.50±0.50	10.00±1.50	10.00±0.50	R	15.50±0.50	14.00±0.50	R	15.50±0.50	R
8	15.50±0.50	15.00±0.50	10.50±0.50	11.50±0.50	R	10.00±0.50	R	10.00±0.50	R	8.5±0.50	10.00±0.50
5	10.00±0.50	14.50±0.50	R	11.50±0.50	15.50±0.50	R	R	11.50±0.50	8.50±0.50	13.25±0.25	8.5±0.50

Isolation and identification of Streptomyces tunisiensis from Garmsar salt cave soil with antibacterial and gene expression activity against Pseudomonas aeruginosa

Abstract

Keywords

1 Introduction

2 Materials and methods

2.1 Collection of soil samples

2.2 Isolation and purification of Streptomyces from soil samples

2.3 Primary diagnosis of Streptomyces

2.4 Collection of clinical samples, phenotypic and biochemical identification of P. aeruginosa

2.5 Molecular detection of the presence of exoA and algD pathogenic genes in Pseudomonas isolates

Table 1 Primers used in PCR of P. aeroginusa species Gene Forward Primer Primer length Reverse Primer Primer length exoA 5-ACATCAAGGTGTTCATCC-3 18 5-GACGAAGAAGGTGGCATC-3 18 oprL 5-TGCGATCACCACCTTCTACTTC-3 22 5-CGCTGACCGCTGCCTTTC-3 18 algD 5-ACGAAGTGGTGGCGAGTTC-3 19 5-TGGTGTGCGGCATGAAGC-3 18

2.7 Evaluation of the effect of isolated metabolites on exoA and algD gene expression

2.8 Methods to detect the metabolite effective on Pseudomonas

2.9 16S rRNA sequencing of selected Streptomyces strains

Table 2 Primers used for PCR of selected Streptomyces strains Temperature attachment (°C) Primer sequence (3-5) Primer 60 AAGAGTTTGATCATGGCTCAG 9F 68 AGGAGGTGATCCAACCGCA 1541R

3 Results and discussion

3.1 Evaluation of biochemical tests and antibiotic susceptibility of P. aeruginosa strains

References

Table 1
Primers used in PCR of P. aeroginusa species

Gene Forward Primer Primer length Reverse Primer Primer length

exoA 5-ACATCAAGGTGTTCATCC-3 18 5-GACGAAGAAGGTGGCATC-3 18

oprL 5-TGCGATCACCACCTTCTACTTC-3 22 5-CGCTGACCGCTGCCTTTC-3 18

algD 5-ACGAAGTGGTGGCGAGTTC-3 19 5-TGGTGTGCGGCATGAAGC-3 18

Table 2
Primers used for PCR of selected Streptomyces strains

Temperature attachment (°C) Primer sequence (3-5) Primer

60 AAGAGTTTGATCATGGCTCAG 9F

68 AGGAGGTGATCCAACCGCA 1541R