E26 Transformation-Specific Transcription Factor ETS2 as an Oncogene Promotes the Progression of Hypopharyngeal Cancer

Abstract

The E26 transformation-specific (ETS) family is one of the largest families of transcription factors. Upon activation by MAPK pathway, ETS participates in cell proliferation, differentiation, migration, apoptosis, and metastasis. However, the mechanism by which ETS is deregulated in cancer is unclear. In this study, the authors investigated the role of ETS factor, ETS2, in hypopharyngeal cancer pathogenesis in hypopharyngeal cancer tissues (N = 20) and corresponding non-neoplastic tissues (N = 20). The results showed that expression of ETS2 was increased in cancer tissues as compared with the expression in corresponding non-neoplastic tissues. Analysis of clinicopathological characteristics showed that increased level of ETS2 is associated with III–IV tumor node metastasis stage and lymph node metastasis. In addition, knockdown of ETS2 by siRNA in pharyngeal cancer cell line, FaDu, significantly decreased cell's vitality and colony-forming ability by inducing caspase-3-dependent apoptosis and cell cycle arrest. Furthermore, inhibition of ETS2 could abrogate the migration, invasion, and transforming growth factor-β-induced epithelial mesenchymal transition through the upregulation of E-cadherin, zona occludens protein-1, together with downregulation of vimentin and α-sooth muscle actin. These functions of ETS2 could be associated with the activation of MAPK/p38/ERK/JNK signals. Taken together, the authors opined that ETS2 functions as an oncogene and plays a key role in the progression of hypopharyngeal cancer.

Introduction

Hypopharynx cancer (HPC) is a rare form of head and neck squamous cell carcinoma (HNSCC), which arises from the mucosa of the upper aerodigestive tract. High exiting rates from its point of origin and 40% contralateral occult nodal metastases early in the course of the disease are some of the characteristics that result in poor prognosis of HPC as compared with other head and neck cancer sites.^1
–3 Thus, management of HPC is difficult; chemoradiotherapy or extensive surgery often renders patients life-threatening side-effects.⁴ Therefore, an understanding of the potential mechanism of carcinogenesis of HPC is critical to advance the treatment strategy.

The E26 transformation-specific (ETS) refers to the avian erythroblastosis virus E26 transforming gene, which consists of 12 subfamilies according to the gene homology of the characteristic ETS domain.⁵ There are at least 30 human genes of ETS, including Ets1, Ets2, Etv2, Etv6, PDTF, Fli1, and Erg.⁶ The transcription factors of ETS are evolutionarily conserved proto-oncogenes or tumor suppressors and are aberrantly expressed in different human cancers, which contribute to tumor initiation, angiogenesis, and metastatic growth.⁶ During the development of hepatocellular carcinoma (HCC), high level of ETS1 was observed during the early stages; however, the expression significantly decreased in advanced stages. Moreover, HCC patients with high levels of ETS1 have better disease-free survival outcome.^7,8 However, the clinical significance of ETS family in HPC is unclear and required further investigation.

As one of the important substrates of the MAPK/ERK pathway, ETS2 regulates a number of MAPK activation-induced genes involved in tumor development.^9,10 Ets2 is a tumor suppressor gene, which is involved in prostate-specific knockout of Ets2 in PTEN-deficient mice, thus exhibiting a marked progression of prostate adenocarcinoma associated with activation of MAPK signaling.¹¹ In lung adenocarcinoma, ETS2 expression is significantly decreased as compared with normal lung tissues. ETS2 significantly inhibits cancer cell growth, migration, and invasion.¹² However, apart from its antitumor function, ETS2 plays a key role as oncogene during carcinogenesis. Wallace et al. reported fibroblast-specific effector function of ETS2 for tumor growth, wherein ETS2 promoted blood vessel formation to increase tumor angiogenesis.¹³ CSF1-ETS2 pathway activates the expression of miR-21 and mir-29a in myeloid cells, which mediates angiogenesis and metastatic tumor growth.¹⁴ Therefore, the protumor or antitumor effect of ETS2 is dependent on the type of tumor or microenvironment.

In this study, the authors have observed the protumor effects of ETS2 in HPC. The expression of ETS2 was upregulated during carcinogenesis, which results in high III–IV tumor node metastasis (TNM) stage and lymph node metastasis (LNM). Knockdown of ETS2 significantly decreased cell vitality and promoted caspase-3-dependent apoptosis and cell cycle G0/G1 arrest. Moreover, inhibition of ETS2 could abrogate the migration and invasion by inhibiting transforming growth factor-β (TGF-β)-induced epithelial mesenchymal transition (EMT), which is hypothesized to be associated with the activation of the MAPK pathway.

Material and Methods

Tumor samples, cell lines, and reagents

HPC tissues (n = 20) and corresponding relatively normal tissues (n = 20) were collected from Qilu Hospital of Shandong University. This study was approved by the Research Ethics Committee of Qilu Hospital of Shandong University. All these retrospective specimens were handled and made anonymous according to the ethical and legal standards. According to WHO classifications, all of the patients diagnosed with primary HPC were confirmed by hematoxylin and eosin staining by experienced pathologists. Written informed consent was obtained from all of the patients.

The pharyngeal cancer cell line FaDu was purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (Life Technologies), ampicillin, and streptomycin at 37°C, 5% CO₂ conditions. siRNA-ETS2 or negative control was purchased from RiboBio (Guangzhou, China). Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ETS2, caspase-3, cleavage-caspase-3, BCL-2, p38/ERK/JNK, and p-p38/ERK/JNK antibodies were obtained from Cell Signaling Tech (Denver, MA) and Abcam.

Immunohistochemistry for ETS2

The expression of ETS2 in HPC tissues was analyzed on 2-μm-thick, formalin-fixed, and paraffin-embedded specimen sections. Slides were incubated in xylene for 5 minutes and followed by two washes of 100% ethanol for 10 minutes and 95% ethanol for 10 minutes. Antigen unmasking was performed and then the slides were blocked with 3% hydrogen peroxide for 30 minutes at room temperature. Then the primary antibody for ETS2 was incubated the Formalin Fixed Paraffin Embedded specimen sections at 4°C over night. The EnVision Detection System kit (DAKO, Denmark) was used for the Diaminobenzidine chromogen followed by nuclear staining using hematoxylin. The Immunohistochemistry of ETS2 was indicated by the scores.

Western blots

According to the manufacturer's protocol, cells for Western blots were collected and total protein was isolated from the cell samples. Detailed procedures for immunoblotting are described elsewhere.¹⁵ The proteins were extracted and dissolved in sodium dodecyl sulfate polyacrylamide gel electrophoresis loading buffer, separated on 4%–15% polyacrylamide gel, and transferred to nitrocellulose membranes (Amersham Biosciences). The membranes were blocked in 5% nonfat milk in TBST buffer (Tris Buffer Saline containing 0.1% Tween-20) for 1 hour at room temperature, and subsequently incubated with primary antibodies overnight at 4°C. After washing with TBST buffer, the blots were then incubated with HRP-conjugated secondary antibody for 1 hour at room temperature. After washing with TBST buffer, the blots were observed using the ECL-Plus reagent (Millipore, Billerica, MA). GAPDH was used as the loading control in the Western blotting.

RNA isolation and quantitative Real-time Polymerase Chain Reaction

According to the standard RNA isolation protocol, total RNA from tissues or PANC-1cells was extracted using Trizol reagent (Invitrogen). Quantitative real-time reverse transcription Polymerase Chain Reaction was performed, and the expression levels of genes were normalized to GAPDH for gene expression. The primers are listed as Table 1.

Table 1.

The Primers Were Used for quantitative Real-time Polymerase Chain Reaction

Gene	Primer
ETS2	F: TCCGTCAGCGTCACCTACT
ETS2	R: AACCCGTTGCACATCCAG
E-cadherin	F: CAAAGACAAAGAAGGCAAGG
E-cadherin	R: ATGTGGCAATGCGTTCTCTA
ZO-1	F: ACCAGTAAGTCGTCCTGATCC
ZO-1	R: TCGGCCAAATCTTCTCACTCC
Vimentin	F: GACGCCATCAACACCGAGTT
Vimentin	R: CTTTGTCGTTGGTTAGCTGGT
α-SMA	F: AGCACAGAGCAAAAGAGGAA
α-SMA	R: ATAGAGAGACAGCACCGCC

ETS2, transformation-specific2; ZO-1, zona occludens protein-1; α-SMA, α-sooth muscle actin.

Cell transfection

The FaDu cells were seeded into 12 plates and cultured to about 80% confluence. Then the cells were transfected with siRNA-ETS2 or negative control for the indicated time at a concentration of 100 nM by Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

CCK-8 assay

The FaDu cells were harvested after the transfection of siRNA-ETS2 or negative control for the indicated time and washed with phosphate buffer saline (PBS), and then cell counting kit-8 (Kumamoto, Japan) mixed with DMEM was used for cell viability assay, and the absorbance was measured at 450 nm by a microplate reader (BioTek, Synergy™ HTX).

Hoechst staining assay

After transfection of siRNA-ETS2 or negative control, the FaDu cells were cultured for 48 hours. Then the cells were washed with PBS and stained with 0.1 μg/mL Hoechst 33342 (Sigma, St Louis, MO); fluorescence microscopy (OLYMPUS IX71; Olympus Corporation, Tokyo, Japan) was used to detect the changes of nuclear morphology.

Flow cytometer assay

For the cell cycle analysis, FaDu cells were stained with propidium iodide (PI) staining solution (10 μg/mL RNase A and 50 μg/mL PI) at 37°C for 30 minutes in the dark. The cell cycle distribution was analyzed using a flow cytometry provided with the Cell-Quest software. For the apoptosis analysis, the cells were fixed in cold 70% ethanol at −20°C for 2 hours. Ten milligrams per milliliter RNase was added and stained with 2 μL of annexin V mixed with 2 μL of PI (eBioscience) were used according to the manufacturer's instructions. Data were analyzed using a flow cytometry.

Scratch wound assay and transwell assay

The FaDu cells were wounded with a plastic tip that was dragged across the cell monolayer upon cells reached confluence for scratch wound assay. After transfection of siRNA-ETS2 or negative control for 48 hours, five fields were randomly selected and the distances of migrated cells were measured under a light microscope. In transwell assay, 2 × 10⁴ FaDu cells transfected with siRNA-ETS2 or negative control were in the upper chamber of a noncoated transwell insert. For the invasion assay, the upper chamber of the transwell inserts was coated with Matrigel, and tumor cells were plated in the upper chamber of the Matrigel-coated transwell insert. Cells that did not migrate or invade were removed using a cotton swab and were stained by crystal violet and counted under an inverted microscope. Five random views were selected to count the cells.

Statistical analyses

The Statistical Package for Social Sciences version 16.0 (SPSS 16.0; SPSS, Inc., Chicago, IL) and the Prism statistical software package (Version 5.0, Graphpad Software Inc.) were used. Unpaired t-tests or Mann–Whitney U tests were used to compare the two groups, and multiple group comparisons were analyzed with one-way Analysis of Variance. p < 0.05 was considered statistically significant. All experiments were performed at least three times.

Results

High expression of ETS2 correlates with poor clinical outcome in HPC

To investigate the role of ETS2 during the carcinogenesis of hypopharynx, the authors first analyzed the clinical evidence of ETS2 in patients of HPC. Thus, the authors collected HPC tissues (n = 20), and corresponding non-neoplastic tissues (n = 20) and the quantitative Real-time Polymerase Chain Reaction analysis showed that the expression of ETS2 was significantly upregulated in HPC tissues (Tumor) than that in the corresponding non-neoplastic tissue (Normal) (Fig. 1A), and the protein level of ETS2 was also found to be increased in tumor tissues (Fig. 1B, C). Moreover, the authors analyzed the correlations between deregulated ETS2 expression and the clinicopathological characteristics of HPC patients. Patients with higher TNM stage and LNM showed significant higher expression of ETS2 in tumor samples (Fig. 1D). These data indicated that increased ETS2 level participates into the HPC.

FIG. 1.

High expression of ETS2 correlates with poor clinical outcome in HPC. (A) The mRNA level and (B) protein level of ETS2 in HPC and relatively normal tissues were determined by qRT-PCR and WB, which was confirmed by IHC (C) (top, 200× and bottom, 400×). (D) The clinicopathological characteristics of HPC patients were analyzed according to the expression of ETS2. *p < 0.05, **p < 0.01, ***p < 0.001, data represent the means ± SD. HPC, hypopharynx cancer; IHC, Immunohistochemistry; qRT-PCR, quantitative Real-time Polymerase Chain Reaction; SD, standard deviation; WB, western blot.

Knockdown of ETS2 inhibit tumor cell vitality and proliferation

The authors next analyzed the function of ETS2 in tumor cell in vitro. Pharyngeal cancer cell line FaDu was used, and after effective knockdown of ETS2 by siRNA, the cell vitality of FaDu cells was found to be reduced in 48 or 72 hours (Fig. 2A). The authors further proposed a hypothesis that the reduced cell vitality was attributed to the inhibition of proliferation by ETS2 (Fig. 2B). The Brdu assay confirmed that siRNA-ETS2 could impair the ability of proliferation of FaDu (Fig. 2C). Besides, the authors performed the colony formation assay to directly demonstrate its proproliferation effects (Fig. 2D). The results showed that knockdown of ETS2 significantly inhibited the colony formation of FaDu cells.

FIG. 2.

siRNA-ETS2 could reduce the cell vitality of FaDu cells. (A) The efficiency of transfection was determined by qRT-PCR. (B) And the cell vitality was estimated by CCK-8. (C) Brdu assay was performed to indicate the proliferation of FaDu cells transfected with siRNA-ETS2 or negative control (100 × ). (D) The effects of siRNA-ETS2 on the colony formation were also analyzed. **p < 0.01, ***p < 0.001, data represent the means ± SD. qRT-PCR; quantitative Real-time Polymerase Chain Reaction; SD, standard deviation.

ETS2 involves in the cell cycle and apoptosis

The mechanism of decreased cell vitality and proliferation was estimated, the cell cycle of FaDu cells transfected with siRNA-ETS2 was found to be inhibited, which led to G0/G1 arrest (Fig. 3A). Moreover, Hochest assay indicated that abrogating the expression of ETS2 increased the apoptosis of FaDu cells, which was confirmed by flow cytometry (Fig. 3B, C). Thus, the apoptosis pathway was analyzed and the authors found that knockdown of ETS2 could inhibit the expression of antiapoptosis factor BCL-2 and promote the cleavage of caspase-3 (Fig. 3D). The results demonstrated that ETS2 could inhibit tumor cell apoptosis and maintain its tumor cell cycle.

FIG. 3.

ETS2 involves in cell cycle and apoptosis. (A) The cell cycle of FaDu cells was analyzed after transfection of siRNA-ETS2. The impacts of ETS2 on apoptosis were determined by (B) Hochest assay (400 × ) and (C) flow cytometry. (D) The expression levels of apoptosis-related genes Bcl-2/caspase-3 were estimated. *p < 0.05, **p < 0.01, ***p < 0.001, data represent the means ± SD. SD, standard deviation.

Inhibition of ETS2 impairs the ability of migration and invasion

Mounting pieces of evidence had reported that the ETS family involved into the cell migration,¹⁵ thus the authors here investigated the role of ETS2 in HPC. Scratch wound assay and transwell assay were performed (Fig. 4A). The cells transfected with siRNA-control showed similar ability of migration as untreated cells, but siRNA-ETS2 could significantly decrease the migration of FaDu cells. In addition, the invasion of FaDu cells was also determined and the authors found that inhibition of ETS2 also repressed the ability of invasion in vitro (Fig. 4B).

FIG. 4.

ETS2 could promote the migration and invasion of FaDu cells. The ability of migration and invasion was determined by (A) scratch experiment (40 × ) and (B) transwell assay. *p < 0.05, **p < 0.01, ***p < 0.001, data represent the means ± SD. SD, standard deviation.

ETS2 regulates the TGF-β-induced EMT and MAPK pathway in HPC

To understand the molecular mechanism of ETS2 in migration or invasion, the authors further analyzed the impacts of ETS2 on the TGF-β-induced EMT phonotype of FaDu cells. The expression of epithelial markers, E-cadherin and ZO-1, and mesenchymal markers, vimentin and α-SMA, was assessed in mRNA and protein level. The result indicated that inhibition of ETS2 could downregulate the mesenchymal markers through the decreased expression of vimentin and α-SMA, but upregulate the epithelial markers through the increased expression of E-cadherin and ZO-1 (Fig. 5A, B). Because ETS2 was a key downstream of MAPK pathways that control the cell growth and migration and ETS2 also, in turn, affected the MAPK signal, the authors analyzed the role of ETS2 in MAPK signals in FaDu cells (Fig. 5C). The results showed that ETS2 knockdown could inhibit TGF-β-induced activation of the MAPK pathway and inhibit the phosphorylation of p38/ERK/JNK signals. Therefore, ETS2 is required for TGF-β-induced EMT, which might be related to MAPK signals.

FIG. 5.

The FaDu cells were transfected with siRNA-ETS2 or negative control, and after the EMT induction by 10 ng/mL TGF-β, (A and B) the EMT phonotype was determined by the expression of epithelial markers E-cadherin and ZO-1, and mesenchymal markers vimentin and α-SMA were assessed. (C) The activation of the MAPK/p38/ERK/JNK pathway was analyzed by WB. **p < 0.01, ***p < 0.001, data represent the means ± SD. α-SMA, α-sooth muscle actin; EMT, epithelial mesenchymal transition; SD, standard deviation; TGF-β, transforming growth factor-β; ZO-1, zona occludens protein-1.

Discussion

HNSCC is the sixth most common cancer worldwide. HPC—a rare form of HNSCC—accounts for ∼3%–5% of all HNSCCs. HPC is associated with poor worst prognosis, and HPC patients have low 5-year survival rate of 15%–30% due to the high risk of recurrences.³ Thus, it becomes critical to investigate the mechanism of HPC pathogenesis and low clinical prognosis. In this study, the authors investigated the role of ETS transcription factors and oncogene, ETS2, in HPC. The authors observed that high expression of ETS2 was correlated with high III–IV TNM and LNM. ETS2 promoted the proliferation and apoptosis in pharyngeal cancer cell line, whereas the inhibition of ETS2 induced G0/G1 cell cycle arrest and impaired the migration of tumor cell in vitro, which, in turn, led to decreased EMT and inactivation of the MAPK pathway.

ETS factors are found to positively or negatively regulate the expression of genes involved in cell proliferation, differentiation, apoptosis, metastasis, angiogenesis, and carcinogenesis, which are dependent on interaction with other factors.^16,17 Thus, studying the DNA-binding activity and transactivation potential or stability is essential. ETS family members are characterized by unique 85 amino acid ETS DNA-binding domain, which consists of a winged-helix-turn-helix structure and binds with other transcription factors, such as AP1, MafB, and CBP, to core purine-rich sequences of GGAA/T in DNA promoter of target genes, such as cancer-related vascular endothelial-specific gene, MMP1 and MMP3, to induce oncogenesis.^6,18 Deleted in Breast Cancer 1 (DBC1) functioned as a coactivator for the oncogenic ETS transcription factor PEA3 to promote ER-negative breast cancer progression via the inhibition of SIRT1 interaction with PEA3 and of SIRT1-mediated deacetylation of PEA3.¹⁹ In colon cancer, the expression of ETS1 and ETS2 was found to be absent in normal colon and hyperplastic polyps; however, the expression is highly upregulated in tumor tissues, which affects tumor grade and LNM.²⁰ Pointed domain containing ETS transcription factor, another ETS family gene, was found to be highly expressed at mRNA level in breast cancers and was involved in the progression of tumor.²¹ In this study, the authors observed that the expression of ETS2 was remarkably upregulated in HPC when compared with normal samples, and ETS2 was positively correlated with the clinical progression of patients with HPC.

Various pieces of evidence have demonstrated that the ETS family could regulate angiogenesis in normal and cancer tissues. FLT-1 is upregulated during tumor angiogenesis, which stimulates solid tumor growth.²² Conditional TMPRSS2-Erg knockin mice induced significantly increased ERG expression with PTEN loss in prostate cancer.¹¹ Although the antitumor role of ETS2 is established, various studies have reported the role of ETS2 as oncogene in different cancers. In this study, knockdown of ETS2 in pharyngeal cancer cell line induced cell apoptosis, cell cycle G0/G1 arrest, and inhibited migration and invasion by reducing TGF-β-induced EMT. Mathsyaraja et al. reported that the CSF1-ETS2 pathway in macrophages activates the expression of miR-21, mir-29a in myeloid cells, which mediated the angiogenesis and metastatic tumor growth.¹⁴ Kabbout et al. reported that ETS2 knockdown in esophageal SCC promoted cell apoptosis, inhibited cell proliferation, attenuated cell invasion, and induced cell cycle G0/G1 arrest in vitro, and demonstrated the role of ETS2 in inactivation of the mTOR/p70S6K signaling pathway.¹² In this study, the authors observed that the MAPK/p38/ERK/JNK pathway played a key role in ETS2-regulated proliferation, apoptosis, migration, or invasion in HPC. These pieces of evidence indicated the role of ETS2 as tumor suppressor or oncogene depending on the type of tumor.

Taken together, the authors have demonstrated the role of ETS2 as oncogene in HPC, and inhibition of ETS2 could be used as a potential strategy for the treatment of HPC patients.

Footnotes

Acknowledgments

This work was supported by a grant from the Taishan Scholars Program (No. tshw20130950), Shandong Province; the Department of Science & Technology of Shandong Province (Nos. ZR2013HM107, ZR2014HM005, 2015GSF118014, and 2015GSF118030); Science Foundation of Qilu Hospital of Shandong University; and the Fundamental Research Funds of Shandong University (No. 2014QLKY05).

Disclosure Statement

No competing financial interests exist.

References

Hall

, Groome

, Irish

, et al. The natural history of patients with squamous cell carcinoma of the hypopharynx. Laryngoscope, 2008; 118:1362.

Spector

, Sessions

, Haughey

, et al. Delayed regional metastases, distant metastases, and second primary malignancies in squamous cell carcinomas of the larynx and hypopharynx. Laryngoscope, 2001; 111:1079.

Takes

, Strojan

, Silver

, et al. Current trends in initial management of hypopharyngeal cancer: The declining use of open surgery. Head Neck, 2012; 34:270.

Guibert

, Lepage

, Woisard

, et al. Quality of life in patients treated for advanced hypopharyngeal or laryngeal cancer. Eur Ann Otorhinolaryngol Head Neck Dis, 2011; 128:218.

Craig

, Sumanas

. ETS transcription factors in embryonic vascular development. Angiogenesis, 2016; 19:275.

Seth

, Watson

. ETS transcription factors and their emerging roles in human cancer. Eur J Cancer, 2005; 41:2462.

Ito

, Miyoshi

, Takeda

, et al. ets-1 expression in extrahepatic bile duct carcinoma and cholangiocellular carcinoma. Oncology, 2000; 58:248.

Ito

, Miyoshi

, Takeda

, et al. Expression and possible role of ets-1 in hepatocellular carcinoma. Am J Clin Pathol, 2000; 114:719.

Furukawa

, Tanji

, Xu

, et al. Feedback regulation of DUSP6 transcription responding to MAPK1 via ETS2 in human cells. Biochem Biophys Res Commun, 2008; 377:317.

10.

Petrovic

, Bhagwat

, Ratzan

, et al. CD13/APN transcription is induced by RAS/MAPK-mediated phosphorylation of Ets-2 in activated endothelial cells. J Biol Chem, 2003; 278:49358.

11.

Linn

, Penney

, Bronson

, et al. Deletion of interstitial genes between TMPRSS2 and ERG promotes prostate cancer progression. Cancer Res, 2016; 76:1869.

12.

Kabbout

, Garcia

, Fujimoto

, et al. ETS2 mediated tumor suppressive function and MET oncogene inhibition in human non-small cell lung cancer. Clin Cancer Res, 2013; 19:3383.

13.

Wallace

, Li

, Balakrishnan

, et al. Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer. PLoS One, 2013; 8:e71533.

14.

Mathsyaraja

, Thies

, Taffany

, et al. CSF1-ETS2-induced microRNA in myeloid cells promote metastatic tumor growth. Oncogene, 2015; 34:3651.

15.

, Yang

, Han

, et al. Ets2 knockdown inhibits tumorigenesis in esophageal squamous cell carcinoma in vivo and in vitro. Oncotarget, 2016; 7:61458.

16.

Sieweke

, Tekotte

, Frampton

, et al. MafB is an interaction partner and repressor of Ets-1 that inhibits erythroid differentiation. Cell, 1996; 85:49.

17.

Baillat

, Begue

, Stehelin

, et al. ETS-1 transcription factor binds cooperatively to the palindromic head to head ETS-binding sites of the stromelysin-1 promoter by counteracting autoinhibition. J Biol Chem, 2002; 277:29386.

18.

Takeda

, Liu

, Sasagawa

, et al. HGF-MET signals via the MLL-ETS2 complex in hepatocellular carcinoma. J Clin Invest, 2013; 123:3154.

19.

Kim

, Kim

, Yu

, et al. A positive role of DBC1 in PEA3-mediated progression of estrogen receptor-negative breast cancer. Oncogene, 2015; 34:4500.

20.

Ito

, Takeda

, Okada

, et al. Expression of ets-1 and ets-2 in colonic neoplasms. Anticancer Res, 2002; 22:1581.

21.

Feldman

, Sementchenko

, Gayed

, et al. Pdef expression in human breast cancer is correlated with invasive potential and altered gene expression. Cancer Res, 2003; 63:4626.

22.

Muramatsu

, Yamamoto

, Osawa

, et al. Vascular endothelial growth factor receptor-1 signaling promotes mobilization of macrophage lineage cells from bone marrow and stimulates solid tumor growth. Cancer Res, 2010; 70:8211.