Dent Disease 1 Associated with a Rare Novel Renal Chloride Channel 5 Variant in a Chinese Family

Abstract

Dent disease 1, an X-linked recessive proximal tubulopathy most commonly caused by CLCN5 variants, often presents with heterogeneous and nonspecific phenotypes that hinder clinical diagnosis in the absence of molecular data. We investigated a Chinese kindred with suspected hereditary renal disease using whole-exome sequencing and comprehensive in silico analyses and identified a novel frameshift variant in CLCN5 (NM_001127899: c.2359dupG/p.R788Afs*24). Segregation analysis showed the proband to be hemizygous, with his mother and daughter as heterozygous carriers. Pathogenicity prediction, domain mapping against published CLCN5 variants, and literature review indicate that this variant lies within a functionally critical, variant-hotspot region of the protein where truncating variants correlate with classic Dent disease 1 phenotypes. Molecular docking and structural modeling further predict destabilization of the H⁺/Cl⁻ exchange transporter 5 (CLC-5) dimer and reduced adenosine triphosphate (ATP)/adenosine diphosphate (ADP) binding affinity attributable to the frameshift, providing mechanistic plausibility for impaired channel function. Collectively, genetic, bioinformatic, and structural evidence support the p.R788Afs24 mutant as a likely pathogenic allele underlying the proband’s renal phenotype, expanding the variant spectrum of CLCN5 and underscoring the necessity of genetic testing for accurate diagnosis and management of Dent disease 1.

Keywords

Dent disease 1 CLCN5 variant whole-exome sequencing

Introduction

Dent disease 1 (Dent 1, OMIM #300009) is a rare X-linked recessive hereditary tubulopathy, clinically characterized by low-molecular-weight proteinuria (LMWP), hypercalciuria, hematuria, nephrolithiasis, nephrocalcinosis, and progressive renal failure (Arnous et al., 2023). The precise prevalence of Dent1 remains undetermined, with current estimates ranging from 1 in 400,000 to 1 in 1,000,000 individuals based on reported cases (Bokenkamp et al., 2025). However, the actual prevalence is likely higher due to the disease’s insidious nature and heterogeneous clinical manifestations. Male patients typically exhibit distinct clinical symptoms, with 30 − 80% progressing to end-stage renal disease between 30 and 50 years of age (Burballa et al., 2023). In contrast, female individuals are mostly asymptomatic carriers, often overlooked due to indistinct symptoms (Quinlan and Rheault, 2022).

The primary pathogenic factor underlying Dent 1 is variants in the CLCN5 gene (Jiang et al., 2025; Macaluso et al., 2025). Chloride voltage-gated channel 5, mapped to chromosome Xp11.22, belongs to the voltage-gated chloride channel gene family (Shipman and Weisz, 2020). CLCN5 is predominantly expressed in renal proximal tubule epithelial cells (Shipman and Weisz, 2020). CLCN5 encodes the CLC-5 protein, an 816-amino acid polypeptide that localizes to the plasma membrane and endosomal membrane (Arnous et al., 2023; Qiao et al., 2025). Structurally, CLC-5 contains 18 α-helices, harbors two phosphorylation sites and one N-glycosylation site, and functions as a homodimer (Lyu et al., 2024; Schmieder et al., 2007). As a highly conserved voltage-gated 2Cl⁻/H⁺ antiporter, CLC-5 mediates chloride influx to neutralize the transmembrane positive charge generated by proton pumping via the V-type H⁺-ATPase, thereby maintaining the acidic microenvironment of endosomes and facilitating endocytosis of low-molecular-weight proteins (Chang et al., 2020; Satoh et al., 2017). Additionally, the cytoplasmic domain of CLC-5 directly binds ATP and ADP), enhancing its transport activity (Meyer et al., 2007). Studies in mice have demonstrated that ClC-5 deficiency recapitulates the phenotypic features of Dent 1 (Lyu et al., 2024; Maritzen et al., 2006; Piwon et al., 2000).

In this study, we used whole-exome sequencing (WES) to identify genetic differences in a Chinese family with hereditary chronic kidney disease (CKD). Combining bioinformatics analysis and Sanger sequencing, a novel frameshift variant (NM_001127899: c.2359dupG/p.R788Afs*24) of CLCN5 was identified in this family. Identification of this variant has expanded the genetic spectrum of CLCN5, which is beneficial for the early identification of genetic diseases and genetic counseling.

Material and Methods

Subjects

We enrolled family members of a patient with kidney disease from the Hunan Province in Central South China (Changsha, China) at Xiangya Hospital of Central South University (Hunan, China) (Fig. 1A). The proband was diagnosed with CKD. The family member (I-2) self-reported a history of increased urinary protein detected during previous medical examinations, but it was not given attention due to her lack of specific discomfort. The remaining 4 members (I-1, II-2, III-1, and III-2) don’t have abnormal phenotypes. Blood was obtained from the affected probands and their family members in January 2023. The study protocol was approved by the Review Board of Xiangya Hospital of Central South University in China, adhered to the principles of the Declaration of Helsinki. The study participants gave informed consent. The ethics approval number of the study is 2022020629.

FIG. 1.

Clinical data and genetic analysis of the proband. (A) The family pedigree of the proband. Symbols indicate male members (squares); female members (circles); affected members (closed symbols); unaffected members (open symbols); carriers of sex interlocking recessive genes (semi-filled symbols); and the proband (arrow). (B) Sanger sequencing of CLCN5 showing the NM_001127899: c.2359dupG/p.R788Afs*24 variant. (C) The renal ultrasound examination of the proband. (D) Structure prediction of the wild type CLCN5 (WT) protein structure and the mutant CLCN5 (p.R788Afs*24) protein structure. (E) The conservation analysis of the related amino acid region. (F) and (G) Multi-species sequence alignment of amino acids 786–816 of the CLCN5 protein. (H) The tolerant analysis of the related amino acid region.

Whole exome sequencing

Lymphocytes were isolated from the peripheral blood, and genomic DNA was extracted from all family members. Genomic DNA was prepared using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA, Cat.No.69506) according to the manufacturer’s instructions. WES was performed by Kingstar Genomics (Wuhan, China). The exomes capture was performed using the Agilent SureSelect Human All Exon V6 kit (Agilent Technologies, Santa Clara, CA, USA, 5190-8863) according to the manufacturer’s instructions. The Illumina HiSeq X-10 (Illumina, Inc., San Diego, CA, USA) was used to perform high-throughput sequencing. The sequencing reads were aligned to the human reference genome (GRCh37/hg19). Basic bioinformatics analyses, including reads, mapping, variant detection, filtering, and annotation, were performed by Berry Genomics Co., Ltd. (Beijing, China).

Variants were filtered to retain exonic and splice-site variants, excluding those located in intronic, intergenic, and untranslated regions as well as synonymous single nucleotide variations. Common variants with a minor allele frequency (MAF) ≥0.01 were excluded based on data from the 1000 Genomes Project (http://www.1000genomes.org), the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org), and an in-house exome database of Berry Genomics. The pathogenicity of retained variants was predicted using MutationTaster (http://www.mutationtaster.org), PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/index.shtml), and SIFT (https://sift.bii.a-star.edu.sg). Clinical relevance was further assessed using the Online Mendelian Inheritance in Man (OMIM) database and the Human Gene Mutation Database (HGMD). Variant classification was performed according to the American College of Medical Genetics and Genomics (ACMG) guidelines for variant interpretation. Variant validation and co-segregation analysis

After filtering, variant and co-segregation analyses among all family members were validated using Sanger sequencing, as previously outlined (Tang et al., 2022). Primers for the polymerase chain reaction (PCR) amplification were designed using Primer 3 (Table 1). The PCR process began with an initial denaturation step at 95°C for 3 min, followed by 35 cycles using 2× Power Taq PCR MasterMix (BioTeke, Beijing, China, PR1710). Each cycle consisted of denaturation at 95°C for 30 s, annealing at 59°C (based on primer design) for 30 s, and extension at 72°C for 60 s (Chang et al., 2025). The sequencing was completed by BioSune Biotechnology Co., Ltd. (Shanghai, China).

Table 1.

CLCN5 PCR Primers

Primer	Sequence
Forward primers	5′TGCTCGAAAGAAACAGGATGG3′
Rerverse primers	5′GGTTCGCCATCTGTGCTATATG3′

Bioinformatics analysis

ConSurf Server software (https://consurf.tau.ac.il/) was used to evaluate the conservation of amino acid positions affected by variant. MetaDome software (https://stuart.radboudumc.nl/metadome/dashboard) was used to evaluate the variant tolerance of amino acid positions affected by gene variant. SWISS-MODEL software (https://swissmodel.expasy.org/interactive) was used to perform mutant modeling and visual analysis of protein differences before and after variant. ClusPro software (https://cluspro.org) was employed for protein–protein docking simulations. CB-DOCK2 software (https://cadd.labshare.cn/cb-dock2/php/index.php) was employed for protein-ligand blind docking (Liu et al., 2022). PRODIGY software was utilized to predict the binding affinity in protein–protein complexes (Vangone and Bonvin, 2017; Xue et al., 2016). PyMOL was used to create high-quality visualizations of the biomolecular structures.

Results

Clinical data

We enrolled a Chinese family with hereditary tubular kidney disease from Hunan Province, Central South China (Fig. 1A). The proband (II-1) is now a 47-year-old post-kidney transplant patient who was admitted due to hematuria. The proband (II-1) developed end-stage renal failure at 28 years of age with unknown etiology. Pre-renal transplantation renal function tests showed blood urea nitrogen and serum creatinine levels as high as 54.42 mmol/L and 1060 µmol/L, respectively. Urinalysis revealed 2+ protein, 1+ blood, and 1+ glucose. The proband had excessive excretion of low-molecular-weight proteins, particularly b2-microglobulin (81.73 µg/mL) (Table 2). Abdominal ultrasound revealed bilateral renal parenchymal disease, polycystic kidney with partial cyst wall calcification, and suggestive of multiple small stones in both kidneys (Fig. 1C). In addition, the patient showed normal growth and development without any evidence of rickets. Because urinary calcium excretion was not measured, we could not determine whether the patient had hypercalciuria. The patient had never undergone renal biopsy. The patient underwent renal transplantation in 2013 and is currently doing well. During this period, the patient’s family members exhibited no signs of significant kidney damage (Table 3).

Table 2.

The Clinical Testing Data of the Proband

Measure parameters	Data	Reference ranges
Peripheral blood
Red blood cells	2.65*10^12/L	4.0–5.5*10^12/L
Hemoglobin	74 g/L	120–160 g/L
Blood chemistry
Creatinine	1703 µmol/L	53–106 µmol/L
Uric acid	558 µmol/L	149–416 µmol/L
Urea nitrogen	47.82 mmol/L	3.2–7.1 mmol/L
Phosphorus	2.79 mmol/L	0.74–1.39 mmol/L
Calcium	1.86 mmol/L	2.25–2.75 mmol/L
Chlorine	96.2 mmol/L	96–106 mmol/L
Urine chemistry
Protein	++	—
Glucose	+	—
Blood	+	—
Red blood cells	33.8/µL	0–5/µL
Renal tubule function
Tf-CLIA	4777.72 ng/mL	<2350 ng/mL
ALB	191.27 ng/mL	<20 ng/mL
B2-MG	81.73 µg/mL	0–0.3 µg/mL
RBP	46.0 ng/mL
Urine protein electrophoresis
Macromolecular protein	23.87%
Medium molecular protein	55.31%
Low molecular protein	20.82%

Table 3.

The Clinical Information of the Family

No.	Age (year)	Sex	Variants found	Symptoms/healthy
I-1	70	Male	Normal	Healthy
I-2	67	Female	Heterozygote	Proteinuria?
II-1	47	Male	Homozygote	CKD
II-2	45	Female	Normal	Healthy
III-1	22	Male	Normal	Healthy
III-2	19	Female	Heterozygote	Healthy

Genetic and bioinformatics analysis

To identify the disease-causing genes in this proband, we performed WES. A mean of 13.83 Gb of data was obtained from WES. We used databases such as the 1000 Genomes database and gnomAD to filter out common variants and predicted pathogenicity using ACMG guidelines. Based on a comprehensive analysis combining OMIM, HGMD, and relevant literature reports, we strongly suspect that a CLCN5 variant (NM_001127899: c.2359dupG/p.R788Afs*24) is the genetic cause of the proband’s renal disease (Fig. 1B). This frameshift variant maps to the 14th exon of the CLCN5 gene. This variant has not been reported previously and is absent from the gnomAD and 1000 Genomes Project (MAF＜0.00001). The variant was disease-causing, as evaluated using MutationTaster. Using PolyPhen-2, the variant was predicted to be “possibly damaging” with a score of 0.830 (sensitivity: 0.84; specificity: 0.93). In SIFT, the variant was predicted to be deleterious. Based on ACMG guidelines, the novel variant was classified as pathogenic (PVS1 + PS1+PS4 + PM1+PM2 + PM4+PP1). Sanger sequencing also confirmed the presence of the CLCN5 variant in this family (Fig. 1B). Sequencing results for the mother and daughter of the proband indicated the simultaneous detection of both the new variant and the normal expression sequence at this locus. However, the father and son were only found to have the regular expression sequence at this locus (Fig. 1B). This variant was inherited from the patient’s asymptomatic mother and passed on to the daughter. SWISS-MODEL software showed that the frameshift variant may lead to mistranslation of 24 amino acids following the variant site, disrupting the original α-helix and β-folded structures and causing abnormal truncation of the protein (Fig. 1D). Using the ConSurf Server software in conjunction with multiple sequence alignment, the analysis revealed that the affected amino acids are mostly highly conserved in evolution (Fig. 1E, F, and G). Furthermore, MetaDome software indicated that most of the affected amino acids have a low tolerance to the variant (Fig. 1H). Therefore, we inferred that the CLCN5 variant was the pathogenic cause in the proband. Information supporting the data for the results reported in the article can be found in the submitted article. The original data of the proband generated using WES has been uploaded to the China National Center for Bioinformation (accession number: HRA006047, URL: https://ngdc.cncb.ac.cn/gsa-human/s/hzj3Me4t).

The CLC-5 protein typically adopts a dimeric conformation, with each monomer forming an independent ion-conducting pore (Wu et al., 2003). Dimerization is essential for maintaining structural stability, facilitating ion transport, and enabling cooperative gating regulation. Specific pathogenic variants (e.g., R345W) disrupt dimer assembly, resulting in CLC-5 loss-of-function, impaired endocytosis, and consequent manifestations, including low-molecular-weight proteinuria and hypercalciuria (Chang et al., 2020). Within the CLC-5 dimer, the majority of the N-terminus is membrane-embedded, while a cytoplasmic segment of the C-terminus (residues 640–816) is exposed to the intracellular milieu (Lourdel et al., 2012). We employed the PRODIGY software to assess the binding affinity of three forms of CLC-5 dimers: WT-WT, WT-p.R788Afs24, and p.R788Afs24-p.R788Afs*24 (Fig. 2A). The results indicated that the binding affinity of the dimer formed by the mutated protein and the normal protein was reduced compared to the WT-WT dimer. The dimer composed of two mutated proteins exhibited the lowest binding affinity and the poorest stability (Table 4). Utilizing PyMOL, we visualized the molecular structures of these three dimers. The visualizations revealed that, compared to the WT-WT dimer, the dimer formed by the mutated protein and the normal protein had a significantly reduced binding interface at the C-terminus, with the binding interface more concentrated toward the N-terminus. In the dimer composed of two mutated proteins, the binding interface at the C-terminus was almost entirely absent, which is likely to have a highly detrimental impact on the dimerization of CLC-5 (Fig. 2B). The cytoplasmic domain of CLC-5 (residues 640–816) regulates endocytic trafficking in renal tubular epithelial cells by modulating endosomal acidification through its binding of ATP/ADP and Cl⁻ (Meyer et al., 2007). In this study, the p.R788Afs24 frameshift variant led to a translational error in the C-terminal peptide segment of CLC-5, with the erroneously translated peptide segment located in the cytoplasmic domain region (residues 640–816). We utilized the CB-DOCK2 software to compare the binding of the cytoplasmic domain (residues 640–816) of both the WT and the p.R788Afs24 mutant with different ligands (Fig. 2C). The results revealed that, compared to the WT, the p.R788Afs24 mutant exhibited reduced binding capabilities for both ATP and ADP, with a significant decrease in hydrogen bonds and van der Waals forces between the protein and the ligands (Fig. 2D and E). Moreover, the p.R788Afs24 variant also had a certain negative impact on the binding of CLC-5 with Cl⁻ ions (Supplementary Fig. S1). Collectively, these findings indicate that the p.R788Afs*24 variant results in the loss of CLC-5 function.

FIG. 2.

Multiple predictions of dimerization and ligand binding affinities for mutant CLCN5 proteins. (A) Structure prediction of the wild type CLCN5 (WT) protein structure and the mutant CLCN5 (p.R788Afs*24) protein structure. (B) The prediction results of WT-WT, WT-p.R788Afs*24 and p.R788Afs*24-p.R788Afs*24 dimers. (C) Analysis of Binding to ATP/ADP for wild-type and mutant CLCN5 proteins. (D) and (E) LigPlus illustrates the key interaction sites for binding to ATP and ADP in wild-type and mutant CLCN5 proteins.

Table 4.

The Prediction Details of Each Protein–Protein Complex

Protein-protein complex	△G (kcal.mol⁻¹)	Kd (M) at 25°C	ICs intermolecular	ICs charged-charged	ICs charged-polar	ICs charged-apolar	ICs polar-polar	ICs polar-apolar	ICs apolar-apolar	NIS charged	NIS apolar
WT-WT	−12.0	1.5e-09	152	3	4	37	0	17	91	24.21	45.08
WT-p.R788Afs*24	−8.5	6e-07	125	3	1	22	0	8	91	24.27	45.03
p.R788Afs24-p.R788Afs24	−9.6	9.7e-08	116	1	0	25	1	13	76	23.89	45.14

△G, predicted binding affinity; Kd, predicted dissociation constant; ICs intermolecular, number of intermolecular contacts; ICs charged-charged, number of charged-charged contacts; ICs charged-polar, number of charged-polar contacts; ICs charged-apolar, number of charged-apolar contacts; ICs polar-polar, number of polar-polar contacts; ICs polar-apolar, number of apolar-polar contacts; ICs apolar-apolar, number of apolar-apolar contacts; NIS charged, percentage of charged NIS residues; NIS apolar, percentage of apolar NIS residues.

Discussion

In this study, we identified a novel CLCN5 variant (NM_001127899: c.2359dupG/p.R788Afs*24) in the proband through WES. The variant was confirmed in the patient’s mother and daughter. MutationTaster, PolyPhen-2, and SIFT predicted that this variant was deleterious. This finding provides a more precise diagnosis of Dent 1 in our proband, offering theoretical support for optimizing post-transplant management of the proband. Additionally, this study reveals a potential genetic family history of the proband, which can be used to enhance awareness and self-management of Dent 1 and CKD among family members through strengthened health education. The discovery of this novel variant expands the genetic spectrum of CLCN5, holding significant implications for genetic counseling and prenatal diagnosis for the proband’s daughter.

The clinical manifestations of Dent 1 are varied, with hypercalciuria, nephrolithiasis, and nephrocalcinosis being relatively specific symptoms. However, these symptoms may not be present in all Dent 1 patients. LMWP and progressive renal function decline are more common in adult patients with Dent 1 but are less specific. Recent studies have also shown that high urinary calcium, renal calcium deposition, or kidney stone symptoms were present in only 66.4%, 44.4%, and 26.4% of over 200 Dent 1 patients in Europe, respectively (Burballa et al., 2023). There have also been Dent 1 cases with stunted growth and rickets. Due to the heterogeneity of clinical presentations, whole exome sequencing can better assist in the diagnosis of Dent 1 and the discovery of novel variants. Genetic testing analysis can assist in diagnosis. To date, >200 variants in CLCN5 have been recorded in the HGMD. More than half of which are missense, nonsense, and frameshift variants (caused by deletion or insertion) (Gianesello et al., 2021). The relationship between CLCN5 variant types and clinical phenotypes remains unclear, and genetic heterogeneity means some patients with unexplained CKD are likely to have incomplete Dent 1 manifestations (Arnous et al., 2023; Gianesello et al., 2021). To better understand the relationship between CLCN5 variants and Dent 1, we conducted a classification analysis of known variants in HGMD, examining their types, protein structures, and pathogenicity. A Sankey diagram visualized these data, demonstrating a strong association between variants in the CBS2 domain and the complete Dent 1 phenotype (Fig. 3A).

FIG. 3.

Review of published pathogenic reports on the CLCN5 variant. (A) The correlation analysis of CLCN5 variant types, protein structures, and pathogenicity. (B) Overview of all known CLCN5 variants in the cystathionine beta-synthase 2 (CBS2) domain.

The cytoplasmic domain of CLC-5 plays a pivotal role in maintaining chloride channel function and renal homeostasis, with structural or functional aberrations directly causative of Dent 1 (Meyer et al., 2007). This domain is primarily composed of two highly conserved CBS motifs: CBS1 (amino acids 656–720) and CBS2 (amino acids 752–812) (Wellhauser et al., 2006). Specifically, the CBS2 motif directly mediates ATP/ADP binding (Meyer et al., 2007). Upon nucleotide interaction, CBS2 undergoes a conformational change that allosterically modulates the dynamics of transmembrane domains, thereby enhancing the 2Cl⁻/H⁺ antiport activity of ClC-5 (Grieschat et al., 2020; Meyer et al., 2007). Several Dent 1-associated variants localize to the CBS2 domain, disrupting either nucleotide binding or conformational coupling and resulting in partial or complete loss of CLC-5 function (Jin et al., 2021). Some nonsense (R774X, R788X, and L799X), missense (Y757X, F773S, G773V, L776P, C781W, and K795E), and frameshift (S756TfsX5, F758SfsX3, T764YfsX48, T764NfsX48, T764DfsX48, P765TfsX47, M766WfsX4, and F773PfsX38) variants in the CBS2 domain have been detected in patients (Fig. 3B). In this study, the novel variant induces a frameshift beginning at residue 788, causing a continuous disruption of the downstream amino acid sequence and a premature stop that removes six residues from the C terminus. This truncation compromises the structural integrity of the CBS domain. Variants in R788A and R788X affect the same base sequence in the C-terminal domain. Therefore, we hypothesized that the R788AfsX24 mutant might have inactive functions similar to the R788X mutant. Additionally, binding affinity analysis of CLC-5 with ATP revealed that this novel variant reduces the interfacial contact area of the CLC-5 cytoplasmic domain, significantly weakening van der Waals forces and hydrogen bonding interactions with ATP/ADP. These findings provide mechanistic evidence that the variant may induce Dent 1 by partially or completely ablating CLC-5 function.

Conclusion

In conclusion, we identified a novel CLCN5 frameshift variant (NM_001127899: c.2359dupG/p.R788Afs*24) in a Chinese family with CKD. The present study expands the spectrum of CLCN5 variants and may contribute to the genetic diagnosis and family counseling for patients with CKD. Our study emphasizes the important role of genetic testing for patients and carriers of hereditary kidney disease.

Authors’ Contributions

All authors contributed to the study conception and design. Formal analysis and investigation: S.-Y.Z., J.-Y.J., and L.-L.F.; Writing—original draft preparation: S.-YZ., Y.-X.L., and Z.-J.Y.; Writing—review and editing: S.-Y.Z., Y-X.L., and H.H.; Funding acquisition: H.X., L.Z., and Y.-X.L.; Resources: Y.-X.L. and Q.W.; Supervision: L.Z. and H.H. All authors read and approved the final article.

Footnotes

Acknowledgments

The authors thank all subjects for participating in this study.

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the National Natural Science Foundation of China (82300787, 82270730); Central South University Graduate Research Innovation Project (1053320230947); National Natural Science Foundation of Hunan province (2023JJ40994); Natural Science Project of Changsha City (Kq2403012); National Undergraduate Training Program for Innovation and Entrepreneurship of Central South University (S202410533103); The Scientific Research Program of FuRong Laboratory(No. 2025PT5044); The Natural Science Foundation of Inner Mongolia (2024MS08052), Ordos key research and development plan project (YF20240053) and Inner Mongolia overseas students’ innovation and entrepreneurship start-up support program (Lei Zhu).

Supplemental Material

References

Arnous

, Arroyo

, Cogal

, et al. The site and type of CLCN5 genetic variation impact the resulting dent disease-1 phenotype. Kidney Int Rep, 2023; 8(6):1220–1230.

Bokenkamp

, Ariceta

, Bockenhauer

, et al. Dent disease: Clinical practice recommendations. Nephrol Dial Transplant, 2025; 40(5):852–864.

Burballa

, Cantero-Recasens

, Prikhodina

, et al.; DENT study group. Clinical and genetic characteristics of dent’s disease type 1 in Europe. Nephrol Dial Transplant, 2023; 38(6):1497–1507.

Chang

, Brown

, Liu

, et al. Cl(−) and H(+) coupling properties and subcellular localizations of wildtype and disease-associated variants of the voltage-gated Cl(−)/H(+) exchanger ClC-5. J Biol Chem, 2020; 295(6):1464–1473.

Chang

, Wang

, Jin

, et al. Rare SRRM2 mutation in neurodevelopmental disorders involving hyperphagia triggering severe obesity and other complication. Front Med (Lausanne), 2025; 12:1492851.

Gianesello

, DEL Prete

, Anglani

, et al. Genetics and phenotypic heterogeneity of dent disease: The dark side of the moon. Hum Genet, 2021; 140(3):401–421.

Grieschat

, Guzman

, Langschwager

, et al. Metabolic energy sensing by mammalian CLC anion/proton exchangers. EMBO Rep, 2020; 21(6):e47872.

Jiang

, Lin

, Zhu

, et al. Clinical features and genetic analysis of nine chinese children with dent disease and identification of three novel CLCN5 and OCRL variants. Ren Fail, 2025; 47(1):2476222.

Jin

, Huang

, Quan

, et al. Dent disease: Classification, heterogeneity and diagnosis. World J Pediatr, 2021; 17(1):52–57.

10.

Liu

, Yang

, Gan

, et al. CB-Dock2: Improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting. Nucleic Acids Res, 2022; 50(W1):W159–W164.

11.

Lourdel

, Grand

, Burgos

, et al. ClC-5 mutations associated with dent’s disease: A major role of the dimer interface. Pflugers Arch, 2012; 463(2):247–256.

12.

Lyu

, Yadav

, Yoo

, et al. Gene therapy of dent disease type 1 in newborn ClC-5 null mice for sustained transgene expression and gene therapy effects. Gene Ther, 2024; 31(11–12):563–571.

13.

Macaluso

, Perez

, Soliva

, et al. Molecular simulations meet personalized medicine: The mechanism of action of CLC-5 antiporter and the origin of dent’s disease. PNAS Nexus, 2025; 4(11):pgaf353.

14.

Maritzen

, Rickheit

, Schmitt

, et al. Kidney-specific upregulation of vitamin D3 target genes in ClC-5 KO mice. Kidney Int, 2006; 70(1):79–87.

15.

Meyer

, Savaresi

, Forster

, et al. Nucleotide recognition by the cytoplasmic domain of the human chloride transporter ClC-5. Nat Struct Mol Biol, 2007; 14(1):60–67.

16.

Piwon

, Gunther

, Schwake

, et al. ClC-5 Cl-channel disruption impairs endocytosis in a mouse model for dent’s disease. Nature, 2000; 408(6810):369–373.

17.

Qiao

, Liu

, Bottillo

, et al. Three intronic variants altering RNA splicing were identified in the CLCN5 gene by minigene assay. BMC Med Genomics, 2025; 18(1):158.

18.

Quinlan

, Rheault

. X-linked kidney disorders in women. Semin Nephrol, 2022; 42(2):114–121.

19.

Satoh

, Suzuki

, Nakamura

, et al. Functional coupling of V-ATPase and CLC-5. World J Nephrol, 2017; 6(1):14–20.

20.

Schmieder

, Bogliolo

, Ehrenfeld

. N-glycosylation of the Xenopus laevis ClC-5 protein plays a role in cell surface expression, affecting transport activity at the plasma membrane. J Cell Physiol, 2007; 210(2):479–488.

21.

Shipman

, Weisz

. Making a dent in dent disease. Function (Oxf), 2020; 1(2):zqaa017.

22.

Tang

, Liu

, Sheng

, et al. The first case report of CODAS syndrome in chinese population caused by two LONP1 pathogenic mutations. Front Genet, 2022; 13:1031856.

23.

Vangone

, Bonvin

. PRODIGY: A contact-based predictor of binding affinity in protein-protein complexes. Bio Protoc, 2017; 7(3):e2124.

24.

Wellhauser

, Kuo

, Stratford

, et al. Nucleotides bind to the C-terminus of ClC-5. Biochem J, 2006; 398(2):289–294.

25.

, Roche

, Christie

, et al. Modeling study of human renal chloride channel (hCLC-5) mutations suggests a structural-functional relationship. Kidney Int, 2003; 63(4):1426–1432.

26.

Xue

, Rodrigues

, Kastritis

, et al. PRODIGY: A web server for predicting the binding affinity of protein-protein complexes. Bioinformatics, 2016; 32(23):3676–3678.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.48 MB

0.00 MB