Ecotropic Viral Integration Site 5 ( EVI5 ) expression analysis in multiple sclerosis patients

Abstract

BACKGROUND:

Multiple sclerosis (MS) is a complex immune-related disorder of the central nervous system (CNS) in which dysregulation of different classes of T cells are involved. Variants in Ecotropic Viral Integration Site 5 (EVI5) gene has been shown to be significantly associated with MS in different populations.

OBJECTIVES:

However, there is no data regarding relative expression of this gene in peripheral blood of MS patients compared with healthy controls.

METHODS:

In the present study we assessed expression of EVI5 in 50 Iranian MS patients compared with healthy subjects by means of quantitative real time RT-PCR.

RESULTS:

Statistical analyses showed no significant difference in EVI5 relative expression neither between total MS patients and healthy controls nor between age- and sex-based subgroups of patients and controls except for a trend toward significance in patients aged between 30 and 40 years compared with healthy subjects in both sexes ( $P=$ 0.068 and 0.075 for males and females respectively). No significant correlation was found between the expression level of this gene and disease duration, age at onset or Expanded Disability Status Scale (EDSS).

CONCLUSION:

Future studies are needed to explore the role of EVI5 in the pathogenesis of MS.

Keywords

Multiple sclerosis gene expression EVI5

Table 1
The nucleotide sequences of primers and probes as well as the length of the amplified sequence

Gene name	Primer and probe sequence	Primer and probe length	Product length
HPRT1	F: AGCCTAAGATGAGAGTTC	18	88
	R: CACAGAACTAGAACATTGATA	21
	FAM -CATCTGGAGTCCTATTGACATCGC- TAMRA	24
EVI5	F: GGCTGGTCTCGAACTCCTAAC	21	110
	R: AGACACAAACAGACAAGGTAGGC	23
	FAM -ATCCACCCGCCTCAGCCTCCCAAA- TAMRA	20

1. Introduction

Multiple sclerosis (MS) is a complex immune-related disorder of the central nervous system (CNS) [1]. As a demyelinating inflammatory disorder of the CNS, autoimmune responses to myelin antigens are implicated in this disorder. T helper type 1 (Th1) cells as well as interleukin (IL)-17 producing CD4 ${}^{+}$ T cells called Th17 and IL-17-secreting $\gamma\delta$ T cells have been shown to participate in the pathogenesis of MS disorder [2]. Several genetic loci have been shown to regulate T cell function and participate in autoimmune disorders such as MS. Among MS related genetic loci is Ecotropic Viral Integration Site 5 (EVI5) which has been shown to be significantly associated with MS in a Dutch genetically isolated population as well as Canadian population [3]. This gene had been previously designated as an oncogene which regulates cell cycle progression by stabilizing the FBXO5 protein and promoting cyclin-A gathering during interphase [4]. In addition, it has been shown to facilitate cytokinesis by acting as a GTPase Activating Protein (GAP) for Rab11 [5]. EVI5 has also been found to be a frequent site for retroviral integration which is associated with T cell lymphomagenesis [6]. However, the exact role of it in the regulation of T-cell function and its putative link with MS associated retroviral elements are not clear [7]. Although the role of EVI5 in T-cell mediated immunity has not yet been clarified, it has been suggested that EVI5 might influence the expression and function of proteins involved in innate immunity such as toll-like receptor via Rab11, which participates in transport of the receptor through recycling endosomes [8]. In the present study, we aimed at evaluation of EVI5 expression in the peripheral blood of MS patients compared with healthy subjects to explore the role of it in the pathogenesis of MS.

2. Material and methods

2.1 Participants

The current study is a case-control study to compare EVI5 expression levels between 50 Iranian RRMS patients and 50 healthy subjects. RRMS has been diagnosed by neurologists according to the revised McDonald criteria [9]. Patients were chosen from the formerly HLA-typed clinically stable MS patients. Regarding the role of HLA-DRB1*15 as an important risk factor for MS [10], we excluded HLA-DRB1*15 positive patients from the study. All of patients were receiving daily injections of IFN- $\beta$ (CinnoVex, Cinagene Company, Iran). The control group included 50 healthy age and sex matched volunteers without any neurological disorders. The study protocol was approved by the Ethical Committee of Hamadan University of Medical Sciences. Informed consents were obtained from all participants.

2.2 Sampling and RNA extraction

Five ml of peripheral blood was gathered from all participants in an EDTA tube. Geneall Hybrid-RTM blood RNA extraction Kit (cat No.305-101) was used for total RNA extraction. RNA concentration was assessed by 260/280 nM absorbance using Nanodrop equipment (Thermo Scientific).

2.3 cDNA synthesis and quantitative RT-PCR

cDNA was synthesized by using Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (PN: 4375575) based on the manufacturer’s protocol and stored at $-$ 20 ${}^{\circ}$ C till the polymerase chain reaction (PCR). Specific primers and probes for EVI5 and HPRT1 as the reference gene were designed by using Allele ID 7 for x64 windows software (Premier Biosoft, Palo Alto, USA). The primers and probes sequences and PCR product length are shown in Table 1.

Applied Biosystems TaqMan ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ Universal PCR Master Mix (PN: 4304449) was used for quantitative real time PCR reactions in a Corbett Rotor-gene 6000 system. Thermal cycling program included a primary activation step for 5 minutes at 95 ${}^{\circ}$ C followed by 40 cycles at 95 ${}^{\circ}$ C for 15 seconds and 65 ${}^{\circ}$ C for 1 minute. The $\Delta\Delta$ Ct method was applied for relative expression analysis.

Table 2
Demographic and clinical characteristics of RRMS patients and controls

Variables	MS patients	Healthy subjects
Female/male [no. (%)]	40 (80%)/10 (20%)	33 (66%)/17 (34%)
Age (mean $\pm$ SD, Y)	36.2 $\pm$ 2.9	35.3 $\pm$ 2.1
Age range (Y)	17–55	22–60
Age of onset (mean $\pm$ SD, Y)	31.41 $\pm$ 2.8	–
Relapsing-remitting course (no. %)	100 (100%)	–
Disease duration (mean $\pm$ SD, Y)	4.58 $\pm$ 3.2	–
EDSS (mean $\pm$ SD)	3.07 $\pm$ 2.7	–

Table 3

EVI5 relative expression in distinct subgroups of MS patients and controls

EVI5 expression		MS patients	Controls	Expression	$\Delta\Delta$ CT	Standard	$P$ value	95% Highest
		number	number	ratio		deviation		Density Interval
Total		50	50	0.8061	$-$ 0.4105	0.64	0.251	[ $-$ 1.67 0.84]
Male		9	16	0.8986	$-$ 0.179	1.19	0.795	[ $-$ 2.53 2.18]
Female		41	34	0.7272	$-$ 0.612	0.78	0.151	[ $-$ 2.156 0.91]
$<$ 30	Male	1	11	2.4162	–	–	–	–
	Female	13	23	1.1436	0.232	1.19	0.715	[ $-$ 2.13 2.58]
30–40	Male	4	2	0.1413	$-$ 3.61	21.55	0.068	[ $-$ 10.53 3.46]
	Female	17	8	0.2420	$-$ 2.709	1.6	0.075	[ $-$ 5.87 0.46]
$>$ 40	Male	4	3	0.6162	$-$ 0.942	3.52	0.451	[ $-$ 7.29 5.34]
	Female	11	3	1.5788	0.8521	3.5	0.411	[ $-$ 3.52 5.3]

Figure 1.

The results of interaction effects between sex and disease group.

2.4 Statistical analysis

To test the significance of difference in means between 2 groups OpenBUGS 3.2.2 (OpenBUGS Foundation, London, UK) was used to fit two-sample Bayesian t-test. A normal prior distribution was assumed for parameters with 200000 iterations. Bayesian independent T-test is an alternative to a t test, providing much wealthy information about the samples and the difference in means than a simple $P$ value. Spearman rank order correlation test was used for the assessment of the correlation between EVI5 relative expression and clinical variables. The Analysis of Covariance (ANCOVA) was applied to control for possible confounding variables and to enhance the statistical power. $P$ values less than 0.05 were regarded as significant.

3. Results

In the study 50 patients with RRMS (40 males and 10 females, mean age $\pm$ SD: 36.2 $\pm$ 2.9 years) and 50 healthy age and sex matched controls (33 males and 17 females, mean age $\pm$ SD: 35.3 $\pm$ 2.1) have participated. Demographic and clinical data of RRMS patients and controls are shown in Table 2.

3.1 Relative expression of EVI5 in patients and healthy subjects

Statistical analyses showed no significant difference in EVI5 relative expression between total MS patients and healthy controls. Furthermore, no significant difference has been found between age- and sex-based subgroups of patients and controls except for a trend toward significance in patients aged between 30 and 40 years compared with healthy subjects in both sexes ( $P=$ 0.068 and 0.075 for males and females respectively). Table 3 shows the relative expression and CT values of EVI5 expression in each age- and sex-based subgroups.

Table 4
The results of ANCOVA test for controlling the effects of the age and sex

Variable	Mean square	F	$P$ value
Group	2.42	0.242	0.838
Sex	7.53	0.752	0.388
Age	0.002	0.0001	0.989
Sex*group	0.788	0.079	0.78

Figure 2.

The results of interaction effects between age and disease group.

Figure 3.

Spearman correlation between EVI5 $\Delta ct$ and EDSS in patients.

Figure 4.

Spearman correlation between EVI5 $\Delta ct$ and disease duration in patients.

Figure 5.

Spearman correlation between EVI5 $\Delta ct$ and age at onset in patients.

After using two-way ANCOVA for adjusting the effects of sex and age, there was no statistically significant difference in the values between patient and control groups ( $P=$ 0.838). Table 4 shows the results of ANCOVA test for controlling the effects of the age and sex.

The interaction effects between sex and disease group as well as age and disease group were insignificant, and the direction of effects among two groups was the same. Figures 1 and 2 show the results of interaction effects between sex and disease group as well as age and disease group respectively.

3.2 EVI5 expression level and Expanded Disability Status Scale (EDSS)

The expression level of EVI5 was evaluated based on the EDSS score among RRMS patients. There was no significant correlation between its expression levels and EDSS (Fig. 3).

3.3 EVI5 expression level and disease duration

The expression level of EVI5 was evaluated based on the disease duration among RRMS patients. There was no significant correlation between its expression levels and disease duration (Fig. 4).

3.4 EVI5 expression level and age at onset

The expression level of EVI5 was evaluated based on age at onset among RRMS patients. There was no significant correlation between its expression levels and age at onset (Fig. 5).

4. Discussion

EVI5 has been previously shown to be associated with MS risk with odds ratios even higher than those from the International MS Consortium [3]. However, the study does not confirm whether the underlying allele functions through EVI5 itself [3]. In addition, there had been no data regarding the expression level of EVI5 in MS patients compared with healthy subjects. In the present study, we evaluated the expression level of EVI5 in MS patients compared with healthy controls. However, we did not find either a significant difference in its expression between patients and controls or any correlation between its expression levels and clinical data of patients such as age at onset, disease duration or EDSS. EVI5 has been known as a “modulator of events during cell division”. Its putative role in wound healing has been suggested by the observation that its high levels of expression lead to cell cycle arrest in dedifferentiated cells until they gathered under the wound epidermis [5]. Considering the role of Th17 cells in wound healing on one hand and autoimmune disorders such as MS on the other hand [11], EVI5 might provide the possible link between regulation of Th17 function and these two processes. Although, there are no functional studies regarding the role of EVI5 in MS pathogenesis, the insignificant difference in EVI5 expression between MS patients and controls as revealed by our study, does not rule out the possible role of EVI5 in the pathogenesis of MS as it has been previously shown that activity of EVI5 may be limited by its nuclear and centrosomal localization [12]. So its cellular localization pattern in MS patients might be different from healthy subjects in spite of the similar expressions between two groups. Further evidences for participation of EVI5 in the MS disorder have originated from its shared localization in endosomal structures with proteins encoded by other MS susceptibility genes including signal transducer and activator of transcription 3 (STAT3), tyrosine kinase 2 (Tyk2) and C-type lectin-like domain family 16A (CLEC16A) [13]. In addition, EVI5 as a centrosomal protein has been shown to bind to $\alpha$ - and $\gamma$ -tubulin [12]. Up to one fifth of cellular proteins in brain are tubulins which participate in axonal migration and longitudinal growth [14]. CSF tubulin levels have been shown to correlate with the course of disease in MS patients [15]. In addition, CSF levels of antitubulin antibodies have been demonstrated to be elevated in MS patients [14]. Considering the interactions between EVI5 and tubulins, and the role of tubulins in the MS development, it was anticipated that EVI5 levels were significantly different between MS patients and controls. However, in the present study we evaluated its expression only in peripheral blood cells of patients and healthy subject. Analysis of its expression levels in CSF might reveal possible clues to its role in MS. In addition, the lack of difference in EVI5 expression between patients and controls might be attributed to the relative small size of the current study. So, future studies with larger sample sizes are needed to explore the possible differences in the expression of this gene between MS patients and controls. In addition, it is necessary to conduct functional immunological studies for evaluation of EVI5 role in the pathogenesis of MS.

Footnotes

Acknowledgments

The current study was supported by a grant from Hamadan University of Medical Sciences (Grant number: 9504221970).

Conflict of interest

The authors declare that they have no conflict of interest.

References

Nazdik

M.K.

Taheri

Sajjadi

Arsang-Jang

Koohpar

Z.K.

Inoko

and Sayad

, Increased expression ratio of matrix metalloproteinase-9 (MMP9) and tissue inhibitor of matrix metalloproteinase (TIMP-1) RNA levels in Iranian multiple sclerosis patients, Human Antibodies 24 (2016), 65–70.

Fletcher

Lalor

Sweeney

Tubridy

and Mills

, T cells in multiple sclerosis and experimental autoimmune encephalomyelitis, Clinical & Experimental Immunology 162 (2010), 1–11.

Hoppenbrouwers

Aulchenko

Ebers

G.C.

Ramagopalan

Oostra

Van Duijn

and Hintzen

, EVI5 is a risk gene for multiple sclerosis, Genes and Immunity 9 (2008), 334.

Eldridge

A.G.

et al., The evi5 oncogene regulates cyclin accumulation by stabilizing the anaphase-promoting complex inhibitor emi1, Cell 124 (Jan 27, 2006), 367.

Lim

Y.S.

and Tang

B.L.

, The Evi5 family in cellular physiology and pathology, FEBS Letters 587 (Jun 19, 2013), 1703.

Liao

Buchberg

A.M.

Jenkins

N.A.

and Copeland

N.G.

, Evi-5, a common site of retroviral integration in AKXD T-cell lymphomas, maps near Gfi-1 on mouse chromosome 5, Journal of Virology 69 (1995), 7132–7137.

Perron

Garson

Bedin

Beseme

Paranhos-Baccala

Komurian-Pradel

Mallet

Tuke

Voisset

and Blond

, Molecular identification of a novel retrovirus repeatedly isolated from patients with multiple sclerosis, Proceedings of the National Academy of Sciences 94 (1997), 7583–7588.

Kagan

J.C.

, Recycling endosomes and TLR signaling – the Rab11 GTPase leads the way, Immunity 33 (2010), 578–580.

Polman

C.H.

Reingold

S.C.

Banwell

Clanet

Cohen

J.A.

Filippi

Fujihara

Havrdova

Hutchinson

and Kappos

, Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria, Annals of Neurology 69 (2011), 292–302.

10.

Mazdeh

Taheri

Sayad

Bahram

Omrani

M.D.

Movafagh

Inoko

Akbari

M.T.

Noroozi

and Hajilooi

, HLA genes as modifiers of response to IFN-β-1a therapy in relapsing-remitting multiple sclerosis, Pharmacogenomics 17 (2016), 489–498.

11.

Brockmann

Giannou

A.D.

Gagliani

and Huber

, Regulation of TH17 Cells and Associated Cytokines in Wound Healing, Tissue Regeneration, and Carcinogenesis, International Journal of Molecular Sciences 18 (2017), 1033.

12.

Faitar

S.L.

Dabbeekeh

J.T.

Ranalli

T.A.

and Cowell

J.K.

, EVI5 is a novel centrosomal protein that binds to α- and γ-tubulin, Genomics 86 (2005), 594–605.

13.

Berge

Leikfoss

I.S.

and Harbo

H.F.

, From identification to characterization of the multiple sclerosis susceptibility gene CLEC16A, International Journal of Molecular Sciences 14 (2013), 4476–4497.

14.

Dujmovic

, Cerebrospinal fluid and blood biomarkers of neuroaxonal damage in multiple sclerosis, Multiple Sclerosis International 2011 (2011).

15.

Semra

Seidi

and Sharief

, Heightened intrathecal release of axonal cytoskeletal proteins in multiple sclerosis is associated with progressive disease and clinical disability, Journal of Neuroimmunology 122 (2002), 132–139.